EMAIL THIS PAGE TO A FRIEND

TNFSF13B

tumor necrosis factor (ligand) superfamily, member 13b

Synonyms: BAFF BLYS CD257 DTL TALL-1 TALL1 THANK TNFSF20 ZTNF4
UniProtKB ID: Q9Y275, E0ADT7, Q6FHD6, Q7Z5J2
Gene ID:
Human(10673) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Mouse(24099) tumor necrosis factor (ligand) superfamily, member 13b
Rat(498666) tumor necrosis factor (ligand) superfamily, member 13b
cow(504507) tumor necrosis factor (ligand) superfamily, member 13b
sheep(101115043) tumor necrosis factor (ligand) superfamily, member 13b
sheep(780517) tumor necrosis factor (ligand) superfamily, member 13b
domestic guinea pig(100730952) tumor necrosis factor (ligand) superfamily, member 13b
naked mole-rat(101722011) tumor necrosis factor (ligand) superfamily, member 13b
Domestic Rabbit(100101577) tumor necrosis factor (ligand) superfamily, member 13b
Zebrafish(561268) tumor necrosis factor (ligand) superfamily, member 13b
dog(485545) tumor necrosis factor (ligand) superfamily, member 13b
Horse(100051550) tumor necrosis factor (ligand) superfamily, member 13b
domestic cat(101088640) tumor necrosis factor (ligand) superfamily, member 13b
chicken(374229) tumor necrosis factor (ligand) superfamily, member 13b
Gene Class: Cytokines_and_Chemokines
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006573 Rosetta Predictions human pricing
NM_001109112 Rosetta Predictions rat pricing
NM_033622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127797 predicted 582
2 SASI_Hs01_00127799 predicted 968
3 SASI_Hs01_00127800 predicted 719
4 SASI_Hs01_00127802 predicted 685
5 SASI_Hs01_00127803 predicted 945
6 SASI_Hs01_00127804 predicted 290
7 SASI_Hs01_00127805 predicted 972
8 SASI_Hs02_00341858 predicted 690
9 SASI_Hs02_00341859 predicted 685
10 SASI_Hs02_00341860 predicted 706
11 SASI_Hs01_00127798 predicted 980
12 SASI_Hs01_00127801 predicted 898
13 SASI_Hs01_00127806 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245240 predicted 827
2 SASI_Rn02_00245241 predicted 873
3 SASI_Rn02_00245242 predicted 990
4 SASI_Rn02_00245243 predicted 531
5 SASI_Rn02_00245244 predicted 646
6 SASI_Rn02_00245245 predicted 400
7 SASI_Rn02_00245246 predicted 977
8 SASI_Rn02_00245247 predicted 865
9 SASI_Rn02_00245248 predicted 904
10 SASI_Rn02_00245249 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092881 predicted 688
2 SASI_Mm01_00092882 predicted 286
3 SASI_Mm02_00337479 predicted 667
4 SASI_Mm01_00092883 predicted 512
5 SASI_Mm01_00092884 predicted 1038
6 SASI_Mm01_00092885 predicted 854
7 SASI_Mm01_00092886 predicted 1063
8 SASI_Mm01_00092887 predicted 978
9 SASI_Mm01_00092889 predicted 274
10 SASI_Mm01_00092890 predicted 868
11 SASI_Mm01_00092888 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033622
TNFSF13B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 13b
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1517s21c1
Sequence:CCGGACGCTAAGTCTCAGGATTTACCTCGAGGTAAATCCTGAGACTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033622.1-967s21c1
Sequence:CCGGGTGACCCTGTTCCGATGTATTCTCGAGAATACATCGGAACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1254s21c1
Sequence:CCGGTTTCTCGTGACCCGTTGAATCCTCGAGGATTCAACGGGTCACGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-671s1c1
Sequence:CCGGGCCATTCTCAACATGATGATACTCGAGTATCATCATGTTGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-263s1c1
Sequence:CCGGGCTCCGAGAAAGGAGAAGATACTCGAGTATCTTCTCCTTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-975s1c1
Sequence:CCGGGTTCCGATGTATTCAGAATATCTCGAGATATTCTGAATACATCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-579s1c1
Sequence:CCGGCCACAGGAACAGACGCGCTTTCTCGAGAAAGCGCGTCTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-1079s1c1
Sequence:CCGGCTCGGGAGAATGCACAGATTTCTCGAGAAATCTGTGCATTCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033622
TNFSF13B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 13b
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1517s21c1
Sequence:CCGGACGCTAAGTCTCAGGATTTACCTCGAGGTAAATCCTGAGACTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033622.1-967s21c1
Sequence:CCGGGTGACCCTGTTCCGATGTATTCTCGAGAATACATCGGAACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1254s21c1
Sequence:CCGGTTTCTCGTGACCCGTTGAATCCTCGAGGATTCAACGGGTCACGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-671s1c1
Sequence:CCGGGCCATTCTCAACATGATGATACTCGAGTATCATCATGTTGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-263s1c1
Sequence:CCGGGCTCCGAGAAAGGAGAAGATACTCGAGTATCTTCTCCTTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-975s1c1
Sequence:CCGGGTTCCGATGTATTCAGAATATCTCGAGATATTCTGAATACATCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-579s1c1
Sequence:CCGGCCACAGGAACAGACGCGCTTTCTCGAGAAAGCGCGTCTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-1079s1c1
Sequence:CCGGCTCGGGAGAATGCACAGATTTCTCGAGAAATCTGTGCATTCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033622
TNFSF13B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 13b
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1517s21c1
Sequence:CCGGACGCTAAGTCTCAGGATTTACCTCGAGGTAAATCCTGAGACTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033622.1-967s21c1
Sequence:CCGGGTGACCCTGTTCCGATGTATTCTCGAGAATACATCGGAACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033622.1-1254s21c1
Sequence:CCGGTTTCTCGTGACCCGTTGAATCCTCGAGGATTCAACGGGTCACGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-671s1c1
Sequence:CCGGGCCATTCTCAACATGATGATACTCGAGTATCATCATGTTGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-263s1c1
Sequence:CCGGGCTCCGAGAAAGGAGAAGATACTCGAGTATCTTCTCCTTTCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-975s1c1
Sequence:CCGGGTTCCGATGTATTCAGAATATCTCGAGATATTCTGAATACATCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-579s1c1
Sequence:CCGGCCACAGGAACAGACGCGCTTTCTCGAGAAAGCGCGTCTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033622.1-1079s1c1
Sequence:CCGGCTCGGGAGAATGCACAGATTTCTCGAGAAATCTGTGCATTCTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006573
TNFSF13B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 13b
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-976s21c1
Sequence:CCGGCCTGAAACACTACCCAATAATCTCGAGATTATTGGGTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-882s21c1
Sequence:CCGGCTACGCCATGGGACATCTAATCTCGAGATTAGATGTCCCATGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-721s21c1
Sequence:CCGGGACAGTGAAACACCAACTATACTCGAGTATAGTTGGTGTTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-985s1c1
Sequence:CCGGCTACCCAATAATTCCTGCTATCTCGAGATAGCAGGAATTATTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-296s1c1
Sequence:CCGGCACGCCTTACTTCTTGCCTTACTCGAGTAAGGCAAGAAGTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-946s1c1
Sequence:CCGGGTGACTTTGTTTCGATGTATTCTCGAGAATACATCGAAACAAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-679s1c1
Sequence:CCGGCCAGAAGAAACAGTCACTCAACTCGAGTTGAGTGACTGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-720s1c1
Sequence:CCGGAGACAGTGAAACACCAACTATCTCGAGATAGTTGGTGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006573
TNFSF13B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 13b
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-976s21c1
Sequence:CCGGCCTGAAACACTACCCAATAATCTCGAGATTATTGGGTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-882s21c1
Sequence:CCGGCTACGCCATGGGACATCTAATCTCGAGATTAGATGTCCCATGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-721s21c1
Sequence:CCGGGACAGTGAAACACCAACTATACTCGAGTATAGTTGGTGTTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-985s1c1
Sequence:CCGGCTACCCAATAATTCCTGCTATCTCGAGATAGCAGGAATTATTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-296s1c1
Sequence:CCGGCACGCCTTACTTCTTGCCTTACTCGAGTAAGGCAAGAAGTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-946s1c1
Sequence:CCGGGTGACTTTGTTTCGATGTATTCTCGAGAATACATCGAAACAAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-679s1c1
Sequence:CCGGCCAGAAGAAACAGTCACTCAACTCGAGTTGAGTGACTGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-720s1c1
Sequence:CCGGAGACAGTGAAACACCAACTATCTCGAGATAGTTGGTGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006573
TNFSF13B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 13b
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-976s21c1
Sequence:CCGGCCTGAAACACTACCCAATAATCTCGAGATTATTGGGTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-882s21c1
Sequence:CCGGCTACGCCATGGGACATCTAATCTCGAGATTAGATGTCCCATGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006573.3-721s21c1
Sequence:CCGGGACAGTGAAACACCAACTATACTCGAGTATAGTTGGTGTTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-985s1c1
Sequence:CCGGCTACCCAATAATTCCTGCTATCTCGAGATAGCAGGAATTATTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-296s1c1
Sequence:CCGGCACGCCTTACTTCTTGCCTTACTCGAGTAAGGCAAGAAGTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-946s1c1
Sequence:CCGGGTGACTTTGTTTCGATGTATTCTCGAGAATACATCGAAACAAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-679s1c1
Sequence:CCGGCCAGAAGAAACAGTCACTCAACTCGAGTTGAGTGACTGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006573.3-720s1c1
Sequence:CCGGAGACAGTGAAACACCAACTATCTCGAGATAGTTGGTGTTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks