EMAIL THIS PAGE TO A FRIEND

TNFSF14

tumor necrosis factor (ligand) superfamily, member 14

Synonyms: CD258 HVEML LIGHT LTg TR2
Gene ID:
Human(8740) Summary: The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(50930) tumor necrosis factor (ligand) superfamily, member 14
Rat(301133) tumor necrosis factor (ligand) superfamily, member 14
domestic cat(101096542) tumor necrosis factor (ligand) superfamily, member 14
dog(611306) tumor necrosis factor (ligand) superfamily, member 14
naked mole-rat(101725636) tumor necrosis factor (ligand) superfamily, member 14
domestic guinea pig(100725147) tumor necrosis factor (ligand) superfamily, member 14
cow(505521) tumor necrosis factor (ligand) superfamily, member 14
Gene Class: Cytokines_and_Chemokines
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003807 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137531 MISSION® esiRNA esiRNA human TNFSF14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003807 Rosetta Predictions human pricing
NM_172014 Rosetta Predictions human pricing
XM_001059278 Rosetta Predictions rat pricing
XM_236794 Rosetta Predictions rat pricing
NM_019418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226027 predicted 640
2 SASI_Hs02_00336341 predicted 913
3 SASI_Hs01_00226028 predicted 793
4 SASI_Hs01_00226029 predicted 418
5 SASI_Hs01_00226030 predicted 712
6 SASI_Hs01_00226031 predicted 785
7 SASI_Hs01_00226032 predicted 782
8 SASI_Hs01_00226033 predicted 704
9 SASI_Hs01_00226034 predicted 797
10 SASI_Hs02_00336342 predicted 619
11 SASI_Hs01_00226025 predicted 407
12 SASI_Hs01_00226026 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367774 predicted 396
2 SASI_Hs01_00228054 predicted 531
3 SASI_Hs01_00228055 predicted 807
4 SASI_Hs01_00228056 predicted 685
5 SASI_Hs01_00228057 predicted 416
6 SASI_Hs01_00228058 predicted 604
7 SASI_Hs01_00228059 predicted 672
8 SASI_Hs01_00228060 predicted 672
9 SASI_Hs01_00228061 predicted 603
10 SASI_Hs01_00228062 predicted 685
11 SASI_Hs01_00228063 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292697 predicted 504
2 SASI_Rn02_00292698 predicted 614
3 SASI_Rn02_00292699 predicted 220
4 SASI_Rn02_00292700 predicted 506
5 SASI_Rn02_00292701 predicted 251
6 SASI_Rn02_00292702 predicted 554
7 SASI_Rn02_00292703 predicted 528
8 SASI_Rn02_00292704 predicted 524
9 SASI_Rn02_00292705 predicted 490
10 SASI_Rn02_00292706 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135367 predicted 506
2 SASI_Rn01_00135368 predicted 613
3 SASI_Rn01_00135369 predicted 221
4 SASI_Rn01_00135371 predicted 505
5 SASI_Rn01_00135372 predicted 249
6 SASI_Rn01_00135374 predicted 555
7 SASI_Rn02_00390450 predicted 525
8 SASI_Rn01_00135375 predicted 523
9 SASI_Rn01_00135376 predicted 491
10 SASI_Rn02_00390451 predicted 536
11 SASI_Rn01_00135370 predicted 462
12 SASI_Rn01_00135373 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028681 predicted 811
2 SASI_Mm01_00028682 predicted 1107
3 SASI_Mm01_00028683 predicted 722
4 SASI_Mm02_00324342 predicted 639
5 SASI_Mm01_00028684 predicted 354
6 SASI_Mm01_00028685 predicted 1135
7 SASI_Mm01_00028686 predicted 693
8 SASI_Mm01_00028687 predicted 513
9 SASI_Mm01_00028688 predicted 1154
10 SASI_Mm01_00028689 predicted 660
11 SASI_Mm01_00028690 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019418
TNFSF14 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-528s1c1
Sequence:CCGGGCCCGGTTACTACTATGTGTACTCGAGTACACATAGTAGTAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-358s1c1
Sequence:CCGGGAGAAGCTGATACAAGATCAACTCGAGTTGATCTTGTATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-424s1c1
Sequence:CCGGGCCAGCTTGATAGGTATTGGTCTCGAGACCAATACCTATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-292s1c1
Sequence:CCGGCTGAGACTGCATCAACGTCTTCTCGAGAAGACGTTGATGCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-813s1c1
Sequence:CCGGCAGGTCCTATTTCGGAGCTTTCTCGAGAAAGCTCCGAAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019418
TNFSF14 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-528s1c1
Sequence:CCGGGCCCGGTTACTACTATGTGTACTCGAGTACACATAGTAGTAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-358s1c1
Sequence:CCGGGAGAAGCTGATACAAGATCAACTCGAGTTGATCTTGTATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-424s1c1
Sequence:CCGGGCCAGCTTGATAGGTATTGGTCTCGAGACCAATACCTATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-292s1c1
Sequence:CCGGCTGAGACTGCATCAACGTCTTCTCGAGAAGACGTTGATGCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-813s1c1
Sequence:CCGGCAGGTCCTATTTCGGAGCTTTCTCGAGAAAGCTCCGAAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019418
TNFSF14 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-528s1c1
Sequence:CCGGGCCCGGTTACTACTATGTGTACTCGAGTACACATAGTAGTAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-358s1c1
Sequence:CCGGGAGAAGCTGATACAAGATCAACTCGAGTTGATCTTGTATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-424s1c1
Sequence:CCGGGCCAGCTTGATAGGTATTGGTCTCGAGACCAATACCTATCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-292s1c1
Sequence:CCGGCTGAGACTGCATCAACGTCTTCTCGAGAAGACGTTGATGCAGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019418.1-813s1c1
Sequence:CCGGCAGGTCCTATTTCGGAGCTTTCTCGAGAAAGCTCCGAAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003807
TNFSF14 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1037s1c1
Sequence:CCGGGTGCTGGATGAACGCCTGGTTCTCGAGAACCAGGCGTTCATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-712s1c1
Sequence:CCGGGCCGCTGTTATGGGAGACTCACTCGAGTGAGTCTCCCATAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-798s1c1
Sequence:CCGGGCTACTACTACATCTACTCCACTCGAGTGGAGTAGATGTAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1063s1c1
Sequence:CCGGGCGTGATGGTACCCGGTCTTACTCGAGTAAGACCGGGTACCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-426s21c1
Sequence:CCGGGACAGACCGACATCCCATTCACTCGAGTGAATGGGATGTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1342s21c1
Sequence:CCGGTGCCTGCCTGTAATCCAGCTACTCGAGTAGCTGGATTACAGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-617s21c1
Sequence:CCGGTCCTGGGAGCAGCTGATACAACTCGAGTTGTATCAGCTGCTCCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1130s21c1
Sequence:CCGGATGGGTCTGACACGTGGAGAACTCGAGTTCTCCACGTGTCAGACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-1090s21c1
Sequence:CCGGGGCTTTCATGGTGTGAAGGAACTCGAGTTCCTTCACACCATGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003807
TNFSF14 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1037s1c1
Sequence:CCGGGTGCTGGATGAACGCCTGGTTCTCGAGAACCAGGCGTTCATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-712s1c1
Sequence:CCGGGCCGCTGTTATGGGAGACTCACTCGAGTGAGTCTCCCATAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-798s1c1
Sequence:CCGGGCTACTACTACATCTACTCCACTCGAGTGGAGTAGATGTAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1063s1c1
Sequence:CCGGGCGTGATGGTACCCGGTCTTACTCGAGTAAGACCGGGTACCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-426s21c1
Sequence:CCGGGACAGACCGACATCCCATTCACTCGAGTGAATGGGATGTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1342s21c1
Sequence:CCGGTGCCTGCCTGTAATCCAGCTACTCGAGTAGCTGGATTACAGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-617s21c1
Sequence:CCGGTCCTGGGAGCAGCTGATACAACTCGAGTTGTATCAGCTGCTCCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1130s21c1
Sequence:CCGGATGGGTCTGACACGTGGAGAACTCGAGTTCTCCACGTGTCAGACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-1090s21c1
Sequence:CCGGGGCTTTCATGGTGTGAAGGAACTCGAGTTCCTTCACACCATGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003807
TNFSF14 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1037s1c1
Sequence:CCGGGTGCTGGATGAACGCCTGGTTCTCGAGAACCAGGCGTTCATCCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-712s1c1
Sequence:CCGGGCCGCTGTTATGGGAGACTCACTCGAGTGAGTCTCCCATAACAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-798s1c1
Sequence:CCGGGCTACTACTACATCTACTCCACTCGAGTGGAGTAGATGTAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003807.2-1063s1c1
Sequence:CCGGGCGTGATGGTACCCGGTCTTACTCGAGTAAGACCGGGTACCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-426s21c1
Sequence:CCGGGACAGACCGACATCCCATTCACTCGAGTGAATGGGATGTCGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1342s21c1
Sequence:CCGGTGCCTGCCTGTAATCCAGCTACTCGAGTAGCTGGATTACAGGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-617s21c1
Sequence:CCGGTCCTGGGAGCAGCTGATACAACTCGAGTTGTATCAGCTGCTCCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003807.3-1130s21c1
Sequence:CCGGATGGGTCTGACACGTGGAGAACTCGAGTTCTCCACGTGTCAGACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003807.3-1090s21c1
Sequence:CCGGGGCTTTCATGGTGTGAAGGAACTCGAGTTCCTTCACACCATGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks