EMAIL THIS PAGE TO A FRIEND

TNFSF15

tumor necrosis factor (ligand) superfamily, member 15

Synonyms: TL1 TL1A VEGI VEGI192A
UniProtKB ID: O95150, Q3SX69, Q5VJK8, Q5VWH1, Q8NFE9
Gene ID:
Human(9966) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(326623) tumor necrosis factor (ligand) superfamily, member 15
Rat(252878) tumor necrosis factor (ligand) superfamily, member 15
cow(514239) tumor necrosis factor (ligand) superfamily, member 15
sheep(101102957) tumor necrosis factor (ligand) superfamily, member 15
domestic guinea pig(100725797) tumor necrosis factor (ligand) superfamily, member 15
naked mole-rat(101720658) tumor necrosis factor (ligand) superfamily, member 15
chicken(417247) tumor necrosis factor (ligand) superfamily, member 15
domestic cat(101099505) tumor necrosis factor (ligand) superfamily, member 15
dog(481688) tumor necrosis factor (ligand) superfamily, member 15
Gene Class: Cytokines_and_Chemokines
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005118 Rosetta Predictions human pricing
NM_145765 Rosetta Predictions rat pricing
NM_177371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229678 predicted 361
2 SASI_Hs01_00229680 predicted 1105
3 SASI_Hs01_00229682 predicted 740
4 SASI_Hs01_00229683 predicted 338
5 SASI_Hs01_00229684 predicted 710
6 SASI_Hs02_00339014 predicted 571
7 SASI_Hs02_00339015 predicted 497
8 SASI_Hs01_00229685 predicted 373
9 SASI_Hs01_00229686 predicted 386
10 SASI_Hs01_00229687 predicted 1136
11 SASI_Hs01_00229679 predicted 805
12 SASI_Hs01_00229681 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111278 predicted 529
2 SASI_Rn01_00111279 predicted 436
3 SASI_Rn01_00111280 predicted 340
4 SASI_Rn01_00111281 predicted 350
5 SASI_Rn01_00111283 predicted 412
6 SASI_Rn01_00111284 predicted 418
7 SASI_Rn01_00111285 predicted 403
8 SASI_Rn01_00111286 predicted 349
9 SASI_Rn01_00111287 predicted 201
10 SASI_Rn02_00268747 predicted 288
11 SASI_Rn01_00111282 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190922 predicted 744
2 SASI_Mm01_00190923 predicted 650
3 SASI_Mm01_00190924 predicted 791
4 SASI_Mm02_00347530 predicted 924
5 SASI_Mm01_00190925 predicted 962
6 SASI_Mm01_00190926 predicted 1001
7 SASI_Mm01_00190927 predicted 258
8 SASI_Mm01_00190928 predicted 847
9 SASI_Mm01_00190929 predicted 1058
10 SASI_Mm01_00190930 predicted 891
11 SASI_Mm01_00190931 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005118
TNFSF15 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005118.2-866s21c1
Sequence:CCGGACTATAGGAGGAGAGCAAATACTCGAGTATTTGCTCTCCTCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005118.2-1131s21c1
Sequence:CCGGATTAAGACACTGATCACTAAACTCGAGTTTAGTGATCAGTGTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-360s1c1
Sequence:CCGGCAGCAAGTTTATGCACCTCTTCTCGAGAAGAGGTGCATAAACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-762s1c1
Sequence:CCGGGCCATGTTCTCCTTGCAAGAACTCGAGTTCTTGCAAGGAGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-659s1c1
Sequence:CCGGCACCAAGGTAACAGACAGCTACTCGAGTAGCTGTCTGTTACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-545s1c1
Sequence:CCGGGTCGGGAGACTACTTCATTTACTCGAGTAAATGAAGTAGTCTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-503s1c1
Sequence:CCGGGAACCGAATGAACTATACCAACTCGAGTTGGTATAGTTCATTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005118
TNFSF15 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005118.2-866s21c1
Sequence:CCGGACTATAGGAGGAGAGCAAATACTCGAGTATTTGCTCTCCTCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005118.2-1131s21c1
Sequence:CCGGATTAAGACACTGATCACTAAACTCGAGTTTAGTGATCAGTGTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-360s1c1
Sequence:CCGGCAGCAAGTTTATGCACCTCTTCTCGAGAAGAGGTGCATAAACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-762s1c1
Sequence:CCGGGCCATGTTCTCCTTGCAAGAACTCGAGTTCTTGCAAGGAGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-659s1c1
Sequence:CCGGCACCAAGGTAACAGACAGCTACTCGAGTAGCTGTCTGTTACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-545s1c1
Sequence:CCGGGTCGGGAGACTACTTCATTTACTCGAGTAAATGAAGTAGTCTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-503s1c1
Sequence:CCGGGAACCGAATGAACTATACCAACTCGAGTTGGTATAGTTCATTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005118
TNFSF15 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005118.2-866s21c1
Sequence:CCGGACTATAGGAGGAGAGCAAATACTCGAGTATTTGCTCTCCTCCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005118.2-1131s21c1
Sequence:CCGGATTAAGACACTGATCACTAAACTCGAGTTTAGTGATCAGTGTCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-360s1c1
Sequence:CCGGCAGCAAGTTTATGCACCTCTTCTCGAGAAGAGGTGCATAAACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-762s1c1
Sequence:CCGGGCCATGTTCTCCTTGCAAGAACTCGAGTTCTTGCAAGGAGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-659s1c1
Sequence:CCGGCACCAAGGTAACAGACAGCTACTCGAGTAGCTGTCTGTTACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-545s1c1
Sequence:CCGGGTCGGGAGACTACTTCATTTACTCGAGTAAATGAAGTAGTCTCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005118.2-503s1c1
Sequence:CCGGGAACCGAATGAACTATACCAACTCGAGTTGGTATAGTTCATTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177371
TNFSF15 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-287s1c1
Sequence:CCGGCGAGAGCACACCTGACAATTACTCGAGTAATTGTCAGGTGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-603s1c1
Sequence:CCGGTGTGTGTGAAATAAGCAACAACTCGAGTTGTTGCTTATTTCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-393s1c1
Sequence:CCGGCGGGATGAAGTACATCAACAACTCGAGTTGTTGATGTACTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-579s1c1
Sequence:CCGGCCGCCTACTAACAGGGTCCAACTCGAGTTGGACCCTGTTAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-426s1c1
Sequence:CCGGCCCAGAGTCAGGAGACTATTTCTCGAGAAATAGTCTCCTGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177371
TNFSF15 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-287s1c1
Sequence:CCGGCGAGAGCACACCTGACAATTACTCGAGTAATTGTCAGGTGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-603s1c1
Sequence:CCGGTGTGTGTGAAATAAGCAACAACTCGAGTTGTTGCTTATTTCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-393s1c1
Sequence:CCGGCGGGATGAAGTACATCAACAACTCGAGTTGTTGATGTACTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-579s1c1
Sequence:CCGGCCGCCTACTAACAGGGTCCAACTCGAGTTGGACCCTGTTAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-426s1c1
Sequence:CCGGCCCAGAGTCAGGAGACTATTTCTCGAGAAATAGTCTCCTGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177371
TNFSF15 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-287s1c1
Sequence:CCGGCGAGAGCACACCTGACAATTACTCGAGTAATTGTCAGGTGTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-603s1c1
Sequence:CCGGTGTGTGTGAAATAAGCAACAACTCGAGTTGTTGCTTATTTCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-393s1c1
Sequence:CCGGCGGGATGAAGTACATCAACAACTCGAGTTGTTGATGTACTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-579s1c1
Sequence:CCGGCCGCCTACTAACAGGGTCCAACTCGAGTTGGACCCTGTTAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177371.1-426s1c1
Sequence:CCGGCCCAGAGTCAGGAGACTATTTCTCGAGAAATAGTCTCCTGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks