EMAIL THIS PAGE TO A FRIEND

TNFSF18

tumor necrosis factor (ligand) superfamily, member 18

Synonyms: AITRL GITRL TL6 hGITRL
UniProtKB ID: Q9UNG2, A9IQG8, O95852, Q6ISV1
Gene ID:
Human(8995) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells. [provided by RefSeq, Jul 2008]
Mouse(240873) tumor necrosis factor (ligand) superfamily, member 18
Rat(364031) tumor necrosis factor (ligand) superfamily, member 18
Zebrafish(100148577) tumor necrosis factor (ligand) superfamily, member 18
domestic cat(101091748) tumor necrosis factor (ligand) superfamily, member 18
dog(611257) tumor necrosis factor (ligand) superfamily, member 18
naked mole-rat(101699588) tumor necrosis factor (ligand) superfamily, member 18
domestic guinea pig(100732404) tumor necrosis factor (ligand) superfamily, member 18
cow(768081) tumor necrosis factor (ligand) superfamily, member 18
sheep(101108765) tumor necrosis factor (ligand) superfamily, member 18
Gene Class: Cytokines_and_Chemokines
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005092 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120871 MISSION® esiRNA esiRNA human TNFSF18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005092 Rosetta Predictions human pricing
XM_001074323 Rosetta Predictions rat pricing
XM_344166 Rosetta Predictions rat pricing
NM_183391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338961 predicted 239
2 SASI_Hs02_00338962 predicted 509
3 SASI_Hs01_00234296 predicted 296
4 SASI_Hs01_00234297 predicted 328
5 SASI_Hs02_00338963 predicted 362
6 SASI_Hs02_00338964 predicted 324
7 SASI_Hs02_00338965 predicted 356
8 SASI_Hs02_00338966 predicted 474
9 SASI_Hs02_00338967 predicted 500
10 SASI_Hs02_00338968 predicted 235
11 SASI_Hs01_00234295 predicted 329
12 SASI_Hs01_00234298 predicted 248
13 SASI_Hs01_00234299 predicted 224
14 SASI_Hs01_00234300 predicted 322
15 SASI_Hs01_00234301 predicted 242
16 SASI_Hs01_00234302 predicted 394
17 SASI_Hs01_00234303 predicted 243
18 SASI_Hs01_00234304 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345789 predicted 200
2 SASI_Rn02_00345790 predicted 358
3 SASI_Rn02_00345791 predicted 472
4 SASI_Rn02_00345792 predicted 504
5 SASI_Rn02_00345793 predicted 439
6 SASI_Rn02_00345794 predicted 492
7 SASI_Rn02_00345795 predicted 293
8 SASI_Rn02_00345796 predicted 495
9 SASI_Rn02_00345797 predicted 245
10 SASI_Rn02_00345798 predicted 96
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396906 predicted 192
2 SASI_Rn02_00396907 predicted 359
3 SASI_Rn02_00396908 predicted 465
4 SASI_Rn02_00396909 predicted 502
5 SASI_Rn02_00396910 predicted 432
6 SASI_Rn02_00396911 predicted 489
7 SASI_Rn02_00396912 predicted 295
8 SASI_Rn02_00396913 predicted 500
9 SASI_Rn02_00396914 predicted 237
10 SASI_Rn02_00396915 predicted 97
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121119 predicted 761
2 SASI_Mm01_00121120 predicted 297
3 SASI_Mm01_00121122 predicted 342
4 SASI_Mm01_00121123 predicted 545
5 SASI_Mm01_00121124 predicted 416
6 SASI_Mm01_00121125 predicted 315
7 SASI_Mm01_00121127 predicted 685
8 SASI_Mm01_00121128 predicted 752
9 SASI_Mm02_00350504 predicted 555
10 SASI_Mm02_00350505 predicted 873
11 SASI_Mm01_00121121 predicted 814
12 SASI_Mm01_00121126 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183391
TNFSF18 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183391.2-1016s1c1
Sequence:CCGGCCTCCTAATGAAACATTGTTACTCGAGTAACAATGTTTCATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-223s1c1
Sequence:CCGGGTTTGAACTATCATCCTCAAACTCGAGTTTGAGGATGATAGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-336s1c1
Sequence:CCGGGCCAAGTGATTCCTGTGGATACTCGAGTATCCACAGGAATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-380s1c1
Sequence:CCGGCCCTTCGTAGTACAGATATATCTCGAGATATATCTGTACTACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-205s1c1
Sequence:CCGGCGAGTCCTGCATGGTTAAGTTCTCGAGAACTTAACCATGCAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183391
TNFSF18 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183391.2-1016s1c1
Sequence:CCGGCCTCCTAATGAAACATTGTTACTCGAGTAACAATGTTTCATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-223s1c1
Sequence:CCGGGTTTGAACTATCATCCTCAAACTCGAGTTTGAGGATGATAGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-336s1c1
Sequence:CCGGGCCAAGTGATTCCTGTGGATACTCGAGTATCCACAGGAATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-380s1c1
Sequence:CCGGCCCTTCGTAGTACAGATATATCTCGAGATATATCTGTACTACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-205s1c1
Sequence:CCGGCGAGTCCTGCATGGTTAAGTTCTCGAGAACTTAACCATGCAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183391
TNFSF18 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183391.2-1016s1c1
Sequence:CCGGCCTCCTAATGAAACATTGTTACTCGAGTAACAATGTTTCATTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-223s1c1
Sequence:CCGGGTTTGAACTATCATCCTCAAACTCGAGTTTGAGGATGATAGTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-336s1c1
Sequence:CCGGGCCAAGTGATTCCTGTGGATACTCGAGTATCCACAGGAATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-380s1c1
Sequence:CCGGCCCTTCGTAGTACAGATATATCTCGAGATATATCTGTACTACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183391.2-205s1c1
Sequence:CCGGCGAGTCCTGCATGGTTAAGTTCTCGAGAACTTAACCATGCAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005092
TNFSF18 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-327s1c1
Sequence:CCGGCCCAATGCAAACTACAATGATCTCGAGATCATTGTAGTTTGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-203s1c1
Sequence:CCGGGTTTGGACCATTACCCTCAAACTCGAGTTTGAGGGTAATGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-241s1c1
Sequence:CCGGCTGAACCTCCTTGCGTGAATACTCGAGTATTCACGCAAGGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-458s1c1
Sequence:CCGGCACCATAGACTTGATATTCAACTCGAGTTGAATATCAAGTCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-139s1c1
Sequence:CCGGCCTTCAGTTGGCTAATCTTTACTCGAGTAAAGATTAGCCAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-98s21c1
Sequence:CCGGTTAAGCCATTCAAGAACTCAACTCGAGTTGAGTTCTTGAATGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-434s21c1
Sequence:CCGGATGATACAAACTCTAACAAACCTCGAGGTTTGTTAGAGTTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005092
TNFSF18 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-327s1c1
Sequence:CCGGCCCAATGCAAACTACAATGATCTCGAGATCATTGTAGTTTGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-203s1c1
Sequence:CCGGGTTTGGACCATTACCCTCAAACTCGAGTTTGAGGGTAATGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-241s1c1
Sequence:CCGGCTGAACCTCCTTGCGTGAATACTCGAGTATTCACGCAAGGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-458s1c1
Sequence:CCGGCACCATAGACTTGATATTCAACTCGAGTTGAATATCAAGTCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-139s1c1
Sequence:CCGGCCTTCAGTTGGCTAATCTTTACTCGAGTAAAGATTAGCCAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-98s21c1
Sequence:CCGGTTAAGCCATTCAAGAACTCAACTCGAGTTGAGTTCTTGAATGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-434s21c1
Sequence:CCGGATGATACAAACTCTAACAAACCTCGAGGTTTGTTAGAGTTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005092
TNFSF18 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-327s1c1
Sequence:CCGGCCCAATGCAAACTACAATGATCTCGAGATCATTGTAGTTTGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-203s1c1
Sequence:CCGGGTTTGGACCATTACCCTCAAACTCGAGTTTGAGGGTAATGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-241s1c1
Sequence:CCGGCTGAACCTCCTTGCGTGAATACTCGAGTATTCACGCAAGGAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-458s1c1
Sequence:CCGGCACCATAGACTTGATATTCAACTCGAGTTGAATATCAAGTCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005092.2-139s1c1
Sequence:CCGGCCTTCAGTTGGCTAATCTTTACTCGAGTAAAGATTAGCCAACTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-98s21c1
Sequence:CCGGTTAAGCCATTCAAGAACTCAACTCGAGTTGAGTTCTTGAATGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005092.3-434s21c1
Sequence:CCGGATGATACAAACTCTAACAAACCTCGAGGTTTGTTAGAGTTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks