EMAIL THIS PAGE TO A FRIEND

TNFSF4

tumor necrosis factor (ligand) superfamily, member 4

Synonyms: CD134L CD252 GP34 OX-40L OX4OL TXGP1
UniProtKB ID: P23510, Q5JZA5, Q9HCN9
Gene ID:
Human(7292) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF4/OX4. It is found to be involved in T cell antigen-presenting cell (APC) interactions. In surface Ig- and CD40-stimulated B cells, this cytokine along with CD70 has been shown to provide CD28-independent costimulatory signals to T cells. This protein and its receptor are reported to directly mediate adhesion of activated T cells to vascular endothelial cells. [provided by RefSeq, Jul 2008]
Mouse(22164) tumor necrosis factor (ligand) superfamily, member 4
Rat(89814) tumor necrosis factor (ligand) superfamily, member 4
cow(539800) tumor necrosis factor (ligand) superfamily, member 4
sheep(101109029) tumor necrosis factor (ligand) superfamily, member 4
domestic guinea pig(100732129) tumor necrosis factor (ligand) superfamily, member 4
naked mole-rat(101698261) tumor necrosis factor (ligand) superfamily, member 4
Domestic Rabbit(100008595) tumor necrosis factor (ligand) superfamily, member 4
chicken(424384) tumor necrosis factor (ligand) superfamily, member 4
domestic cat(790947) tumor necrosis factor (ligand) superfamily, member 4
dog(490339) tumor necrosis factor (ligand) superfamily, member 4
Gene Class: Cytokines_and_Chemokines
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011821 MISSION® esiRNA esiRNA targeting human TNFSF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003326 Rosetta Predictions human pricing
NM_053552 Rosetta Predictions rat pricing
NM_009452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058039 predicted 580
2 SASI_Hs01_00058040 predicted 321
3 SASI_Hs01_00058041 predicted 687
4 SASI_Hs01_00058042 predicted 662
5 SASI_Hs01_00058043 predicted 298
6 SASI_Hs01_00058044 predicted 217
7 SASI_Hs01_00058045 predicted 268
8 SASI_Hs01_00058046 predicted 341
9 SASI_Hs01_00058047 predicted 650
10 SASI_Hs01_00058048 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086708 predicted 599
2 SASI_Rn01_00086709 predicted 548
3 SASI_Rn01_00086710 predicted 736
4 SASI_Rn01_00086712 predicted 452
5 SASI_Rn01_00086713 predicted 535
6 SASI_Rn01_00086714 predicted 636
7 SASI_Rn01_00086715 predicted 715
8 SASI_Rn01_00086716 predicted 687
9 SASI_Rn01_00086717 predicted 288
10 SASI_Rn02_00266206 predicted 221
11 SASI_Rn01_00086711 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102585 predicted 346
2 SASI_Mm01_00102586 predicted 379
3 SASI_Mm01_00102587 predicted 427
4 SASI_Mm01_00102588 predicted 360
5 SASI_Mm01_00102589 predicted 539
6 SASI_Mm01_00102590 predicted 661
7 SASI_Mm01_00102591 predicted 433
8 SASI_Mm01_00102592 predicted 393
9 SASI_Mm01_00102593 predicted 357
10 SASI_Mm01_00102594 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009452
VALIDATED
TNFSF4 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-631s21c1
Sequence:CCGGTGCGAACACCTCCAGATAAATCTCGAGATTTATCTGGAGGTGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-363s21c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-411s21c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009452.2-838s21c1
Sequence:CCGGTTCCTCACTCAGGGATATTTACTCGAGTAAATATCCCTGAGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-543s21c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-366s1c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-484s1c1
Sequence:CCGGGAGGTCAAGATTGACCTTCATCTCGAGATGAAGGTCAATCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-546s1c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-414s1c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-201s1c1
Sequence:CCGGGCCAAGATTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009452
VALIDATED
TNFSF4 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-631s21c1
Sequence:CCGGTGCGAACACCTCCAGATAAATCTCGAGATTTATCTGGAGGTGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-363s21c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-411s21c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009452.2-838s21c1
Sequence:CCGGTTCCTCACTCAGGGATATTTACTCGAGTAAATATCCCTGAGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-543s21c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-366s1c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-484s1c1
Sequence:CCGGGAGGTCAAGATTGACCTTCATCTCGAGATGAAGGTCAATCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-546s1c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-414s1c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-201s1c1
Sequence:CCGGGCCAAGATTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009452
VALIDATED
TNFSF4 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-631s21c1
Sequence:CCGGTGCGAACACCTCCAGATAAATCTCGAGATTTATCTGGAGGTGTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-363s21c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-411s21c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009452.2-838s21c1
Sequence:CCGGTTCCTCACTCAGGGATATTTACTCGAGTAAATATCCCTGAGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009452.2-543s21c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-366s1c1
Sequence:CCGGGCAACTATTCATCAGCTCATACTCGAGTATGAGCTGATGAATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009452.1-484s1c1
Sequence:CCGGGAGGTCAAGATTGACCTTCATCTCGAGATGAAGGTCAATCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-546s1c1
Sequence:CCGGCGATGGTCGAAGGATTGTCTTCTCGAGAAGACAATCCTTCGACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-414s1c1
Sequence:CCGGGCAGAACAATTCGGTTGTCATCTCGAGATGACAACCGAATTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009452.1-201s1c1
Sequence:CCGGGCCAAGATTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003326
VALIDATED
TNFSF4 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000058688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-325s1c1
Sequence:CCGGCCTCGAATTCAAAGTATCAAACTCGAGTTTGATACTTTGAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-574s1c1
Sequence:CCGGGTGGCCTCTCTGACTTACAAACTCGAGTTTGTAAGTCAGAGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003326.2-420s1c1
Sequence:CCGGGCAGAACAACTCAGTCATCATCTCGAGATGATGACTGAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-204s1c1
Sequence:CCGGGCCAAGATTCGAGAGGAACAACTCGAGTTGTTCCTCTCGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003326
VALIDATED
TNFSF4 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000058688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-325s1c1
Sequence:CCGGCCTCGAATTCAAAGTATCAAACTCGAGTTTGATACTTTGAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-574s1c1
Sequence:CCGGGTGGCCTCTCTGACTTACAAACTCGAGTTTGTAAGTCAGAGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003326.2-420s1c1
Sequence:CCGGGCAGAACAACTCAGTCATCATCTCGAGATGATGACTGAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-204s1c1
Sequence:CCGGGCCAAGATTCGAGAGGAACAACTCGAGTTGTTCCTCTCGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003326
VALIDATED
TNFSF4 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000058688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-325s1c1
Sequence:CCGGCCTCGAATTCAAAGTATCAAACTCGAGTTTGATACTTTGAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-574s1c1
Sequence:CCGGGTGGCCTCTCTGACTTACAAACTCGAGTTTGTAAGTCAGAGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_003326.2-420s1c1
Sequence:CCGGGCAGAACAACTCAGTCATCATCTCGAGATGATGACTGAGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003326.2-204s1c1
Sequence:CCGGGCCAAGATTCGAGAGGAACAACTCGAGTTGTTCCTCTCGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks