EMAIL THIS PAGE TO A FRIEND

TNFSF8

tumor necrosis factor (ligand) superfamily, member 8

Synonyms: CD153 CD30L CD30LG
UniProtKB ID: P32971, O43404
Gene ID:
Human(944) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(21949) tumor necrosis factor (ligand) superfamily, member 8
Rat(683163) tumor necrosis factor (ligand) superfamily, member 8
chicken(378930) tumor necrosis factor (ligand) superfamily, member 8
dog(612608) tumor necrosis factor (ligand) superfamily, member 8
domestic cat(101099756) tumor necrosis factor (ligand) superfamily, member 8
naked mole-rat(101720294) tumor necrosis factor (ligand) superfamily, member 8
domestic guinea pig(100735796) tumor necrosis factor (ligand) superfamily, member 8
cow(574056) tumor necrosis factor (ligand) superfamily, member 8
sheep(101102699) tumor necrosis factor (ligand) superfamily, member 8
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001244 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138021 MISSION® esiRNA esiRNA human TNFSF8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001244 Rosetta Predictions human pricing
XM_001064723 Rosetta Predictions rat pricing
NM_009403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099007 predicted 789
2 SASI_Hs01_00099008 predicted 432
3 SASI_Hs01_00099009 predicted 628
4 SASI_Hs01_00099010 predicted 415
5 SASI_Hs01_00099011 predicted 732
6 SASI_Hs02_00331421 predicted 627
7 SASI_Hs01_00099013 predicted 349
8 SASI_Hs01_00099014 predicted 809
9 SASI_Hs01_00099015 predicted 563
10 SASI_Hs01_00099016 predicted 346
11 SASI_Hs01_00099012 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311557 predicted 538
2 SASI_Rn02_00311558 predicted 702
3 SASI_Rn02_00311559 predicted 600
4 SASI_Rn02_00311560 predicted 730
5 SASI_Rn02_00311561 predicted 647
6 SASI_Rn02_00311562 predicted 612
7 SASI_Rn02_00311563 predicted 678
8 SASI_Rn02_00311564 predicted 457
9 SASI_Rn02_00311565 predicted 751
10 SASI_Rn02_00311566 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158509 predicted 566
2 SASI_Mm01_00158510 predicted 398
3 SASI_Mm01_00158511 predicted 932
4 SASI_Mm02_00316035 predicted 951
5 SASI_Mm01_00158512 predicted 871
6 SASI_Mm01_00158513 predicted 943
7 SASI_Mm01_00158514 predicted 821
8 SASI_Mm01_00158515 predicted 845
9 SASI_Mm01_00158516 predicted 918
10 SASI_Mm01_00158517 predicted 846
11 SASI_Mm01_00158518 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009403
TNFSF8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-823s1c1
Sequence:CCGGGCTGCATTACTTACAGGTCAACTCGAGTTGACCTGTAAGTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-404s1c1
Sequence:CCGGGCGATCATTCTGGTACTGGTACTCGAGTACCAGTACCAGAATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-547s1c1
Sequence:CCGGCCAAGTGTCAAAGCATCTCAACTCGAGTTGAGATGCTTTGACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-727s1c1
Sequence:CCGGCCTCATCAATTCCAAGATCAACTCGAGTTGATCTTGGAATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-647s1c1
Sequence:CCGGCCTGGCTTGTACTTCATCGTTCTCGAGAACGATGAAGTACAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009403
TNFSF8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-823s1c1
Sequence:CCGGGCTGCATTACTTACAGGTCAACTCGAGTTGACCTGTAAGTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-404s1c1
Sequence:CCGGGCGATCATTCTGGTACTGGTACTCGAGTACCAGTACCAGAATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-547s1c1
Sequence:CCGGCCAAGTGTCAAAGCATCTCAACTCGAGTTGAGATGCTTTGACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-727s1c1
Sequence:CCGGCCTCATCAATTCCAAGATCAACTCGAGTTGATCTTGGAATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-647s1c1
Sequence:CCGGCCTGGCTTGTACTTCATCGTTCTCGAGAACGATGAAGTACAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009403
TNFSF8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-823s1c1
Sequence:CCGGGCTGCATTACTTACAGGTCAACTCGAGTTGACCTGTAAGTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-404s1c1
Sequence:CCGGGCGATCATTCTGGTACTGGTACTCGAGTACCAGTACCAGAATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-547s1c1
Sequence:CCGGCCAAGTGTCAAAGCATCTCAACTCGAGTTGAGATGCTTTGACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-727s1c1
Sequence:CCGGCCTCATCAATTCCAAGATCAACTCGAGTTGATCTTGGAATTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009403.2-647s1c1
Sequence:CCGGCCTGGCTTGTACTTCATCGTTCTCGAGAACGATGAAGTACAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001244
TNFSF8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-593s1c1
Sequence:CCGGCCTGGTTTGTACTTCATCATTCTCGAGAATGATGAAGTACAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-809s1c1
Sequence:CCGGGTGGATACATTCCAGTACATACTCGAGTATGTACTGGAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-440s1c1
Sequence:CCGGGACCTCTTATGTATCCTGAAACTCGAGTTTCAGGATACATAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-388s1c1
Sequence:CCGGCATTCCCAACTCACCTGACAACTCGAGTTGTCAGGTGAGTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-674s1c1
Sequence:CCGGCTCATCAACAAGCATATCAAACTCGAGTTTGATATGCTTGTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-989s21c1
Sequence:CCGGCAAACTACACAGGGTATTAAACTCGAGTTTAATACCCTGTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-1180s21c1
Sequence:CCGGACTGTATGGTCTTGATCTATTCTCGAGAATAGATCAAGACCATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001244
TNFSF8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-593s1c1
Sequence:CCGGCCTGGTTTGTACTTCATCATTCTCGAGAATGATGAAGTACAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-809s1c1
Sequence:CCGGGTGGATACATTCCAGTACATACTCGAGTATGTACTGGAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-440s1c1
Sequence:CCGGGACCTCTTATGTATCCTGAAACTCGAGTTTCAGGATACATAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-388s1c1
Sequence:CCGGCATTCCCAACTCACCTGACAACTCGAGTTGTCAGGTGAGTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-674s1c1
Sequence:CCGGCTCATCAACAAGCATATCAAACTCGAGTTTGATATGCTTGTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-989s21c1
Sequence:CCGGCAAACTACACAGGGTATTAAACTCGAGTTTAATACCCTGTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-1180s21c1
Sequence:CCGGACTGTATGGTCTTGATCTATTCTCGAGAATAGATCAAGACCATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001244
TNFSF8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-593s1c1
Sequence:CCGGCCTGGTTTGTACTTCATCATTCTCGAGAATGATGAAGTACAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-809s1c1
Sequence:CCGGGTGGATACATTCCAGTACATACTCGAGTATGTACTGGAATGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-440s1c1
Sequence:CCGGGACCTCTTATGTATCCTGAAACTCGAGTTTCAGGATACATAAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-388s1c1
Sequence:CCGGCATTCCCAACTCACCTGACAACTCGAGTTGTCAGGTGAGTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001244.2-674s1c1
Sequence:CCGGCTCATCAACAAGCATATCAAACTCGAGTTTGATATGCTTGTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-989s21c1
Sequence:CCGGCAAACTACACAGGGTATTAAACTCGAGTTTAATACCCTGTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001244.2-1180s21c1
Sequence:CCGGACTGTATGGTCTTGATCTATTCTCGAGAATAGATCAAGACCATACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks