EMAIL THIS PAGE TO A FRIEND

TNFSF9

tumor necrosis factor (ligand) superfamily, member 9

Synonyms: 4-1BB-L CD137L
UniProtKB ID: P41273, Q2M3S2
Gene ID:
Human(8744) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]
Mouse(21950) tumor necrosis factor (ligand) superfamily, member 9
Rat(353218) tumor necrosis factor (ligand) superfamily, member 9
cow(521748) tumor necrosis factor (ligand) superfamily, member 9
sheep(101108388) tumor necrosis factor (ligand) superfamily, member 9
domestic guinea pig(101788800) tumor necrosis factor (ligand) superfamily, member 9
naked mole-rat(101711392) tumor necrosis factor (ligand) superfamily, member 9
domestic cat(101087207) tumor necrosis factor (ligand) superfamily, member 9
dog(476729) tumor necrosis factor (ligand) superfamily, member 9
Gene Class: Cytokines_and_Chemokines
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011081 MISSION® esiRNA esiRNA targeting mouse Tnfsf9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003811 Rosetta Predictions human pricing
NM_181384 Rosetta Predictions rat pricing
NM_009404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034704 predicted 642
2 SASI_Hs02_00336346 predicted 433
3 SASI_Hs01_00034706 predicted 668
4 SASI_Hs01_00034707 predicted 738
5 SASI_Hs01_00034708 predicted 637
6 SASI_Hs01_00034709 predicted 749
7 SASI_Hs01_00034710 predicted 540
8 SASI_Hs01_00034712 predicted 467
9 SASI_Hs01_00034713 predicted 579
10 SASI_Hs02_00336347 predicted 702
11 SASI_Hs01_00034705 predicted 430
12 SASI_Hs01_00034711 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039962 predicted 860
2 SASI_Rn01_00039963 predicted 898
3 SASI_Rn01_00039965 predicted 493
4 SASI_Rn01_00039966 predicted 946
5 SASI_Rn01_00039967 predicted 703
6 SASI_Rn01_00039968 predicted 613
7 SASI_Rn01_00039969 predicted 845
8 SASI_Rn01_00039970 predicted 681
9 SASI_Rn01_00039971 predicted 921
10 SASI_Rn02_00269731 predicted 525
11 SASI_Rn01_00039964 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117501 predicted 505
2 SASI_Mm02_00316036 predicted 896
3 SASI_Mm01_00117504 predicted 285
4 SASI_Mm01_00117505 predicted 289
5 SASI_Mm02_00316037 predicted 209
6 SASI_Mm02_00316038 predicted 852
7 SASI_Mm02_00316039 predicted 806
8 SASI_Mm01_00117508 predicted 381
9 SASI_Mm02_00316040 predicted 872
10 SASI_Mm01_00117509 predicted 721
11 SASI_Mm01_00117502 predicted 618
12 SASI_Mm01_00117503 predicted 523
13 SASI_Mm01_00117506 predicted 243
14 SASI_Mm01_00117507 predicted 470
15 SASI_Mm01_00117510 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003811
TNFSF9 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003811.3-334s21c1
Sequence:CCGGATGTTCTGCTGATCGATGGGCCTCGAGGCCCATCGATCAGCAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003811.3-968s21c1
Sequence:CCGCCAAGTTGGACCTTGATATTTACTCGAGTAAATATCAAGGTCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-755s1c1
Sequence:CCGGCCCTTCACCGAGGTCGGAATACTCGAGTATTCCGACCTCGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-382s1c1
Sequence:CCGGTGAGCTACAAAGAGGACACGACTCGAGTCGTGTCCTCTTTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-431s1c1
Sequence:CCGGCTACTATGTCTTCTTTCAACTCTCGAGAGTTGAAAGAAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-581s1c1
Sequence:CCGGCGAGGCTCGGAACTCGGCCTTCTCGAGAAGGCCGAGTTCCGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003811
TNFSF9 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003811.3-334s21c1
Sequence:CCGGATGTTCTGCTGATCGATGGGCCTCGAGGCCCATCGATCAGCAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003811.3-968s21c1
Sequence:CCGCCAAGTTGGACCTTGATATTTACTCGAGTAAATATCAAGGTCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-755s1c1
Sequence:CCGGCCCTTCACCGAGGTCGGAATACTCGAGTATTCCGACCTCGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-382s1c1
Sequence:CCGGTGAGCTACAAAGAGGACACGACTCGAGTCGTGTCCTCTTTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-431s1c1
Sequence:CCGGCTACTATGTCTTCTTTCAACTCTCGAGAGTTGAAAGAAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-581s1c1
Sequence:CCGGCGAGGCTCGGAACTCGGCCTTCTCGAGAAGGCCGAGTTCCGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003811
TNFSF9 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003811.3-334s21c1
Sequence:CCGGATGTTCTGCTGATCGATGGGCCTCGAGGCCCATCGATCAGCAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003811.3-968s21c1
Sequence:CCGCCAAGTTGGACCTTGATATTTACTCGAGTAAATATCAAGGTCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-755s1c1
Sequence:CCGGCCCTTCACCGAGGTCGGAATACTCGAGTATTCCGACCTCGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-382s1c1
Sequence:CCGGTGAGCTACAAAGAGGACACGACTCGAGTCGTGTCCTCTTTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-431s1c1
Sequence:CCGGCTACTATGTCTTCTTTCAACTCTCGAGAGTTGAAAGAAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003811.2-581s1c1
Sequence:CCGGCGAGGCTCGGAACTCGGCCTTCTCGAGAAGGCCGAGTTCCGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009404
TNFSF9 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-990s21c1
Sequence:CCGGTTGTGACTCCTAGTTGCTAAGCTCGAGCTTAGCAACTAGGAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-489s21c1
Sequence:CCGGTTCGCCAAGCTACTGGCTAAACTCGAGTTTAGCCAGTAGCTTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-511s21c1
Sequence:CCGGACCAAGCATCGTTGTGCAATACTCGAGTATTGCACAACGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-900s21c1
Sequence:CCGGAGAGACTGGGAGCTGTCTTATCTCGAGATAAGACAGCTCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-1054s21c1
Sequence:CCGGTCCATGACTTTCTCTTGTCTTCTCGAGAAGACAAGAGAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-965s21c1
Sequence:CCGGCCCATGGGAATGAGAACTATCCTCGAGGATAGTTCTCATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-937s21c1
Sequence:CCGGTTGGACTCTTTCTTGTGAAACCTCGAGGTTTCACAAGAAAGAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-528s1c1
Sequence:CCGGCCTATCTCAAGGTCTGAGGTACTCGAGTACCTCAGACCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-473s1c1
Sequence:CCGGCGTTGTGCAATACAACTCTGACTCGAGTCAGAGTTGTATTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-363s1c1
Sequence:CCGGCCGAGAGAATAATGCAGACCACTCGAGTGGTCTGCATTATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-746s1c1
Sequence:CCGGAGAACAAGTTAGTGGACCGTTCTCGAGAACGGTCCACTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-175s1c1
Sequence:CCGGCCTGCGGTTAATGTTCGGGATCTCGAGATCCCGAACATTAACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009404
TNFSF9 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-990s21c1
Sequence:CCGGTTGTGACTCCTAGTTGCTAAGCTCGAGCTTAGCAACTAGGAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-489s21c1
Sequence:CCGGTTCGCCAAGCTACTGGCTAAACTCGAGTTTAGCCAGTAGCTTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-511s21c1
Sequence:CCGGACCAAGCATCGTTGTGCAATACTCGAGTATTGCACAACGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-900s21c1
Sequence:CCGGAGAGACTGGGAGCTGTCTTATCTCGAGATAAGACAGCTCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-1054s21c1
Sequence:CCGGTCCATGACTTTCTCTTGTCTTCTCGAGAAGACAAGAGAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-965s21c1
Sequence:CCGGCCCATGGGAATGAGAACTATCCTCGAGGATAGTTCTCATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-937s21c1
Sequence:CCGGTTGGACTCTTTCTTGTGAAACCTCGAGGTTTCACAAGAAAGAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-528s1c1
Sequence:CCGGCCTATCTCAAGGTCTGAGGTACTCGAGTACCTCAGACCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-473s1c1
Sequence:CCGGCGTTGTGCAATACAACTCTGACTCGAGTCAGAGTTGTATTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-363s1c1
Sequence:CCGGCCGAGAGAATAATGCAGACCACTCGAGTGGTCTGCATTATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-746s1c1
Sequence:CCGGAGAACAAGTTAGTGGACCGTTCTCGAGAACGGTCCACTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-175s1c1
Sequence:CCGGCCTGCGGTTAATGTTCGGGATCTCGAGATCCCGAACATTAACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009404
TNFSF9 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-990s21c1
Sequence:CCGGTTGTGACTCCTAGTTGCTAAGCTCGAGCTTAGCAACTAGGAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-489s21c1
Sequence:CCGGTTCGCCAAGCTACTGGCTAAACTCGAGTTTAGCCAGTAGCTTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-511s21c1
Sequence:CCGGACCAAGCATCGTTGTGCAATACTCGAGTATTGCACAACGATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-900s21c1
Sequence:CCGGAGAGACTGGGAGCTGTCTTATCTCGAGATAAGACAGCTCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009404.3-1054s21c1
Sequence:CCGGTCCATGACTTTCTCTTGTCTTCTCGAGAAGACAAGAGAAAGTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-965s21c1
Sequence:CCGGCCCATGGGAATGAGAACTATCCTCGAGGATAGTTCTCATTCCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009404.3-937s21c1
Sequence:CCGGTTGGACTCTTTCTTGTGAAACCTCGAGGTTTCACAAGAAAGAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-528s1c1
Sequence:CCGGCCTATCTCAAGGTCTGAGGTACTCGAGTACCTCAGACCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-473s1c1
Sequence:CCGGCGTTGTGCAATACAACTCTGACTCGAGTCAGAGTTGTATTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-363s1c1
Sequence:CCGGCCGAGAGAATAATGCAGACCACTCGAGTGGTCTGCATTATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-746s1c1
Sequence:CCGGAGAACAAGTTAGTGGACCGTTCTCGAGAACGGTCCACTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009404.1-175s1c1
Sequence:CCGGCCTGCGGTTAATGTTCGGGATCTCGAGATCCCGAACATTAACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks