EMAIL THIS PAGE TO A FRIEND

TNIK

TRAF2 and NCK interacting kinase

Gene ID:
Human(23043) Summary: Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]
Mouse(665113) TRAF2 and NCK interacting kinase
Rat(294917) TRAF2 and NCK interacting kinase
chicken(424987) TRAF2 and NCK interacting kinase
domestic cat(101084310) TRAF2 and NCK interacting kinase
Horse(100057722) TRAF2 and NCK interacting kinase
dog(488166) TRAF2 and NCK interacting kinase
naked mole-rat(101699596) TRAF2 and NCK interacting kinase
domestic guinea pig(100730046) TRAF2 and NCK interacting kinase
cow(539627) TRAF2 and NCK interacting kinase
sheep(101115086) TRAF2 and NCK interacting kinase
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301838 Anti-TNIK affinity isolated antibody mouse, human
immunohistochemistry pricing
T3453 Anti-TNIK (606-620) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412107 ANTI-TNIK antibody produced in mouse clone 4E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412108 ANTI-TNIK antibody produced in mouse clone 3D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108417 Anti-TNIK antibody produced in rabbit affinity isolated antibody mouse, human, horse, rabbit, yeast, guinea pig
western blot pricing
HPA012128 Anti-TNIK antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA012297 Anti-TNIK antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106822 Anti-TNIK antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, yeast, mouse, horse, human
ELISA, western blot pricing
WH0023043M1 Monoclonal Anti-TNIK antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404949 Monoclonal Anti-TNIK, (N-terminal) antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0265 Rabbit anti-TNIK Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, pig, human, gorilla, primate, mouse, bovine, dog, rhesus monkey, rat, rabbit
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_039796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_039796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_039796 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089121 MISSION® esiRNA esiRNA human TNIK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015028 Rosetta Predictions human pricing
NM_001106422 Rosetta Predictions rat pricing
XM_001473602 Rosetta Predictions mouse pricing
XM_001473621 Rosetta Predictions mouse pricing
XM_001474897 Rosetta Predictions mouse pricing
XM_001474909 Rosetta Predictions mouse pricing
XM_976612 Rosetta Predictions mouse pricing
XM_976649 Rosetta Predictions mouse pricing
XM_976684 Rosetta Predictions mouse pricing
XM_976727 Rosetta Predictions mouse pricing
XM_976764 Rosetta Predictions mouse pricing
XM_976804 Rosetta Predictions mouse pricing
XM_976833 Rosetta Predictions mouse pricing
XM_976876 Rosetta Predictions mouse pricing
XM_976912 Rosetta Predictions mouse pricing
XM_976952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346828 predicted 2406
2 SASI_Hs02_00346829 predicted 2664
3 SASI_Hs01_00069673 predicted 3811
4 SASI_Hs01_00069674 predicted 236
5 SASI_Hs01_00069675 predicted 3694
6 SASI_Hs01_00069676 predicted 3236
7 SASI_Hs01_00069677 predicted 2051
8 SASI_Hs01_00069678 predicted 2688
9 SASI_Hs01_00069679 predicted 1568
10 SASI_Hs01_00069680 predicted 3796
11 SASI_Hs01_00069672 predicted 393
12 SASI_Hs01_00069681 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218808 predicted 4035
2 SASI_Rn02_00218809 predicted 3035
3 SASI_Rn02_00218810 predicted 804
4 SASI_Rn02_00218811 predicted 2913
5 SASI_Rn02_00218812 predicted 3621
6 SASI_Rn02_00218813 predicted 4064
7 SASI_Rn02_00218814 predicted 3742
8 SASI_Rn02_00218815 predicted 2605
9 SASI_Rn02_00218816 predicted 4195
10 SASI_Rn02_00218817 predicted 4140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369289 predicted 720
2 SASI_Mm02_00369290 predicted 3774
3 SASI_Mm02_00369291 predicted 865
4 SASI_Mm02_00369292 predicted 3769
5 SASI_Mm02_00369293 predicted 2060
6 SASI_Mm02_00369294 predicted 756
7 SASI_Mm02_00369295 predicted 2063
8 SASI_Mm02_00369296 predicted 698
9 SASI_Mm02_00369297 predicted 3697
10 SASI_Mm02_00369298 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369433 predicted 3692
2 SASI_Mm02_00369434 predicted 3705
3 SASI_Mm02_00369435 predicted 3773
4 SASI_Mm02_00369436 predicted 3696
5 SASI_Mm02_00369437 predicted 2076
6 SASI_Mm02_00369438 predicted 2074
7 SASI_Mm02_00369439 predicted 3739
8 SASI_Mm02_00369440 predicted 3693
9 SASI_Mm02_00369441 predicted 3747
10 SASI_Mm02_00369442 predicted 3679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378636 predicted 3127
2 SASI_Mm02_00378637 predicted 3516
3 SASI_Mm02_00378638 predicted 4113
4 SASI_Mm02_00378639 predicted 4239
5 SASI_Mm02_00378640 predicted 1834
6 SASI_Mm02_00378641 predicted 4287
7 SASI_Mm02_00378642 predicted 4145
8 SASI_Mm02_00378643 predicted 4562
9 SASI_Mm02_00378644 predicted 3953
10 SASI_Mm02_00378645 predicted 2995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378741 predicted 3118
2 SASI_Mm02_00378742 predicted 3514
3 SASI_Mm02_00378743 predicted 4111
4 SASI_Mm02_00378744 predicted 4235
5 SASI_Mm02_00378745 predicted 2824
6 SASI_Mm02_00378746 predicted 4273
7 SASI_Mm02_00378747 predicted 4142
8 SASI_Mm02_00378748 predicted 4553
9 SASI_Mm02_00378749 predicted 3950
10 SASI_Mm02_00378750 predicted 2987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253638 predicted 416
2 SASI_Mm01_00253639 predicted 412
3 SASI_Mm01_00253640 predicted 464
4 SASI_Mm01_00253641 predicted 419
5 SASI_Mm01_00253642 predicted 413
6 SASI_Mm01_00253643 predicted 453
7 SASI_Mm01_00253644 predicted 470
8 SASI_Mm01_00253645 predicted 456
9 SASI_Mm01_00253646 predicted 459
10 SASI_Mm01_00253647 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203092 predicted 416
2 SASI_Mm01_00203093 predicted 418
3 SASI_Mm01_00203094 predicted 427
4 SASI_Mm01_00203095 predicted 417
5 SASI_Mm01_00203096 predicted 448
6 SASI_Mm01_00203097 predicted 477
7 SASI_Mm01_00203098 predicted 505
8 SASI_Mm01_00203099 predicted 620
9 SASI_Mm01_00203100 predicted 572
10 SASI_Mm01_00203101 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246312 predicted 725
2 SASI_Mm01_00246313 predicted 503
3 SASI_Mm01_00246314 predicted 528
4 SASI_Mm01_00246315 predicted 620
5 SASI_Mm01_00246316 predicted 768
6 SASI_Mm01_00246317 predicted 701
7 SASI_Mm01_00246318 predicted 526
8 SASI_Mm01_00246319 predicted 728
9 SASI_Mm01_00246320 predicted 672
10 SASI_Mm01_00246321 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225298 predicted 3040
2 SASI_Mm01_00225299 predicted 3432
3 SASI_Mm01_00225300 predicted 4040
4 SASI_Mm01_00225301 predicted 4155
5 SASI_Mm01_00225302 predicted 2721
6 SASI_Mm01_00225303 predicted 4196
7 SASI_Mm01_00225304 predicted 4063
8 SASI_Mm01_00225305 predicted 3867
9 SASI_Mm01_00225306 predicted 2915
10 SASI_Mm01_00225307 predicted 3481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284900 predicted 3039
2 SASI_Mm01_00284901 predicted 3435
3 SASI_Mm01_00284902 predicted 4035
4 SASI_Mm01_00284903 predicted 2725
5 SASI_Mm01_00284904 predicted 4070
6 SASI_Mm01_00284905 predicted 4011
7 SASI_Mm01_00284906 predicted 1977
8 SASI_Mm01_00284907 predicted 3873
9 SASI_Mm01_00284908 predicted 2918
10 SASI_Mm01_00284909 predicted 3472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252132 predicted 853
2 SASI_Mm01_00252133 predicted 1252
3 SASI_Mm01_00252134 predicted 1849
4 SASI_Mm01_00252135 predicted 1965
5 SASI_Mm01_00252136 predicted 2018
6 SASI_Mm01_00252137 predicted 1880
7 SASI_Mm01_00252138 predicted 1823
8 SASI_Mm01_00252139 predicted 2298
9 SASI_Mm01_00252140 predicted 1681
10 SASI_Mm01_00252141 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232466 predicted 3125
2 SASI_Mm01_00232467 predicted 3516
3 SASI_Mm01_00232468 predicted 4119
4 SASI_Mm01_00232469 predicted 4234
5 SASI_Mm01_00232470 predicted 2830
6 SASI_Mm01_00232471 predicted 4286
7 SASI_Mm01_00232472 predicted 4143
8 SASI_Mm01_00232473 predicted 4561
9 SASI_Mm01_00232474 predicted 3953
10 SASI_Mm01_00232475 predicted 2994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212726 predicted 3001
2 SASI_Mm01_00212727 predicted 3608
3 SASI_Mm01_00212728 predicted 3725
4 SASI_Mm01_00212729 predicted 2286
5 SASI_Mm01_00212730 predicted 3771
6 SASI_Mm01_00212731 predicted 3639
7 SASI_Mm01_00212732 predicted 4052
8 SASI_Mm01_00212733 predicted 3437
9 SASI_Mm01_00212734 predicted 2483
10 SASI_Mm01_00212735 predicted 3043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216899 predicted 3504
2 SASI_Mm01_00216900 predicted 4101
3 SASI_Mm01_00216901 predicted 4221
4 SASI_Mm01_00216902 predicted 1839
5 SASI_Mm01_00216903 predicted 2812
6 SASI_Mm01_00216904 predicted 4266
7 SASI_Mm01_00216905 predicted 4126
8 SASI_Mm01_00216906 predicted 3934
9 SASI_Mm01_00216907 predicted 2973
10 SASI_Mm01_00216908 predicted 3538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235083 predicted 3441
2 SASI_Mm01_00235084 predicted 4037
3 SASI_Mm01_00235085 predicted 4153
4 SASI_Mm01_00235086 predicted 2720
5 SASI_Mm01_00235087 predicted 4196
6 SASI_Mm01_00235088 predicted 4067
7 SASI_Mm01_00235089 predicted 4478
8 SASI_Mm01_00235090 predicted 3874
9 SASI_Mm01_00235091 predicted 2918
10 SASI_Mm01_00235092 predicted 3475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015028
TNIK MISSION shRNA Bacterial Glycerol Stock
TRAF2 and NCK interacting kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3011s1c1
Sequence:CCGGGCGAACTTCTTAGGCAAGAACCTCGAGGTTCTTGCCTAAGAAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3724s1c1
Sequence:CCGGGCTATTGTCATCTTGCCTAAACTCGAGTTTAGGCAAGATGACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2671s1c1
Sequence:CCGGGACAGTTTCAGCGGCAGTATTCTCGAGAATACTGCCGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-1408s1c1
Sequence:CCGGGCTCTACTTCTGGAATATAAGCTCGAGCTTATATTCCAGAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3514s1c1
Sequence:CCGGGCTCCTAAACCGTATCATAAACTCGAGTTTATGATACGGTTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3929s1c1
Sequence:CCGGGACATTTGGATGGAGTATTTACTCGAGTAAATACTCCATCCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3327s1c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-148s1c1
Sequence:CCGGCTTGCAGCCATCAAGGTTATGCTCGAGCATAACCTTGATGGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2401s1c1
Sequence:CCGGGATGAGGATCTGACGGCATTACTCGAGTAATGCCGTCAGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-441s21c1
Sequence:CCGGTAAAGTGATTCATCGAGATATCTCGAGATATCTCGATGAATCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3223s21c1
Sequence:CCGGGGGCAAGGCAAAGTCTATAATCTCGAGATTATAGACTTTGCCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3327s21c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3591s21c1
Sequence:CCGGCACGGTAGAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTCTACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-899s21c1
Sequence:CCGGTTCAACTCAAGGACCATATTGCTCGAGCAATATGGTCCTTGAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015028
TNIK MISSION shRNA shRNA Plasmid DNA
TRAF2 and NCK interacting kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3011s1c1
Sequence:CCGGGCGAACTTCTTAGGCAAGAACCTCGAGGTTCTTGCCTAAGAAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3724s1c1
Sequence:CCGGGCTATTGTCATCTTGCCTAAACTCGAGTTTAGGCAAGATGACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2671s1c1
Sequence:CCGGGACAGTTTCAGCGGCAGTATTCTCGAGAATACTGCCGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-1408s1c1
Sequence:CCGGGCTCTACTTCTGGAATATAAGCTCGAGCTTATATTCCAGAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3514s1c1
Sequence:CCGGGCTCCTAAACCGTATCATAAACTCGAGTTTATGATACGGTTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3929s1c1
Sequence:CCGGGACATTTGGATGGAGTATTTACTCGAGTAAATACTCCATCCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3327s1c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-148s1c1
Sequence:CCGGCTTGCAGCCATCAAGGTTATGCTCGAGCATAACCTTGATGGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2401s1c1
Sequence:CCGGGATGAGGATCTGACGGCATTACTCGAGTAATGCCGTCAGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-441s21c1
Sequence:CCGGTAAAGTGATTCATCGAGATATCTCGAGATATCTCGATGAATCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3223s21c1
Sequence:CCGGGGGCAAGGCAAAGTCTATAATCTCGAGATTATAGACTTTGCCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3327s21c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3591s21c1
Sequence:CCGGCACGGTAGAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTCTACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-899s21c1
Sequence:CCGGTTCAACTCAAGGACCATATTGCTCGAGCAATATGGTCCTTGAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015028
TNIK MISSION shRNA Lentiviral Transduction Particles
TRAF2 and NCK interacting kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3011s1c1
Sequence:CCGGGCGAACTTCTTAGGCAAGAACCTCGAGGTTCTTGCCTAAGAAGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3724s1c1
Sequence:CCGGGCTATTGTCATCTTGCCTAAACTCGAGTTTAGGCAAGATGACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2671s1c1
Sequence:CCGGGACAGTTTCAGCGGCAGTATTCTCGAGAATACTGCCGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-1408s1c1
Sequence:CCGGGCTCTACTTCTGGAATATAAGCTCGAGCTTATATTCCAGAAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3514s1c1
Sequence:CCGGGCTCCTAAACCGTATCATAAACTCGAGTTTATGATACGGTTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3929s1c1
Sequence:CCGGGACATTTGGATGGAGTATTTACTCGAGTAAATACTCCATCCAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-3327s1c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-148s1c1
Sequence:CCGGCTTGCAGCCATCAAGGTTATGCTCGAGCATAACCTTGATGGCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015028.1-2401s1c1
Sequence:CCGGGATGAGGATCTGACGGCATTACTCGAGTAATGCCGTCAGATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-441s21c1
Sequence:CCGGTAAAGTGATTCATCGAGATATCTCGAGATATCTCGATGAATCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3223s21c1
Sequence:CCGGGGGCAAGGCAAAGTCTATAATCTCGAGATTATAGACTTTGCCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3327s21c1
Sequence:CCGGGCTACGAGTTTACTATCTTTCCTCGAGGAAAGATAGTAAACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-3591s21c1
Sequence:CCGGCACGGTAGAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTCTACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015028.1-899s21c1
Sequence:CCGGTTCAACTCAAGGACCATATTGCTCGAGCAATATGGTCCTTGAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_039796
VALIDATED
TNIK MISSION shRNA Bacterial Glycerol Stock
TRAF2 and NCK interacting kinase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000037514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-3935s1c1
Sequence:CCGGCGGTAGAAGAAGGTCAAAGATCTCGAGATCTTTGACCTTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-931s1c1
Sequence:CCGGCCAGAAGTTATTGCCTGTGATCTCGAGATCACAGGCAATAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-4033s1c1
Sequence:CCGGCCATCTCATATTCAGGGCAATCTCGAGATTGCCCTGAATATGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-2358s1c1
Sequence:CCGGGCCTCAAAGAACAACTTCTATCTCGAGATAGAAGTTGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_039796
VALIDATED
TNIK MISSION shRNA shRNA Plasmid DNA
TRAF2 and NCK interacting kinase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000037514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-3935s1c1
Sequence:CCGGCGGTAGAAGAAGGTCAAAGATCTCGAGATCTTTGACCTTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-931s1c1
Sequence:CCGGCCAGAAGTTATTGCCTGTGATCTCGAGATCACAGGCAATAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-4033s1c1
Sequence:CCGGCCATCTCATATTCAGGGCAATCTCGAGATTGCCCTGAATATGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-2358s1c1
Sequence:CCGGGCCTCAAAGAACAACTTCTATCTCGAGATAGAAGTTGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_039796
VALIDATED
TNIK MISSION shRNA Lentiviral Transduction Particles
TRAF2 and NCK interacting kinase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000037514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-3935s1c1
Sequence:CCGGCGGTAGAAGAAGGTCAAAGATCTCGAGATCTTTGACCTTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039796.9-931s1c1
Sequence:CCGGCCAGAAGTTATTGCCTGTGATCTCGAGATCACAGGCAATAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-4033s1c1
Sequence:CCGGCCATCTCATATTCAGGGCAATCTCGAGATTGCCCTGAATATGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_039796.9-2358s1c1
Sequence:CCGGGCCTCAAAGAACAACTTCTATCTCGAGATAGAAGTTGTTCTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks