EMAIL THIS PAGE TO A FRIEND

TNIP1

TNFAIP3 interacting protein 1

Synonyms: ABIN-1 NAF1 VAN nip40-1
Gene ID:
Human(10318) Summary: This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(57783) TNFAIP3 interacting protein 1
Rat(363599) TNFAIP3 interacting protein 1
Zebrafish(449958) TNFAIP3 interacting protein 1
Horse(100060176) TNFAIP3 interacting protein 1
domestic cat(101080511) TNFAIP3 interacting protein 1
dog(489178) TNFAIP3 interacting protein 1
chicken(100858009) TNFAIP3 interacting protein 1
cow(526103) TNFAIP3 interacting protein 1
sheep(101104657) TNFAIP3 interacting protein 1
domestic guinea pig(100732261) TNFAIP3 interacting protein 1
naked mole-rat(101701889) TNFAIP3 interacting protein 1
Domestic Rabbit(100346263) TNFAIP3 interacting protein 1
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075271 MISSION® esiRNA esiRNA human TNIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006058 Rosetta Predictions human pricing
NM_001108826 Rosetta Predictions rat pricing
NM_021327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340815 predicted 2546
2 SASI_Hs01_00168570 predicted 1172
3 SASI_Hs01_00168571 predicted 1603
4 SASI_Hs01_00168572 predicted 2873
5 SASI_Hs01_00168573 predicted 678
6 SASI_Hs02_00340816 predicted 2541
7 SASI_Hs01_00168574 predicted 856
8 SASI_Hs01_00168575 predicted 1548
9 SASI_Hs02_00340817 predicted 2999
10 SASI_Hs01_00168576 predicted 1896
11 SASI_Hs01_00168577 predicted 580
12 SASI_Hs01_00168578 predicted 1106
13 SASI_Hs01_00168579 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242455 predicted 1839
2 SASI_Rn02_00242456 predicted 726
3 SASI_Rn02_00242457 predicted 1416
4 SASI_Rn02_00242458 predicted 1298
5 SASI_Rn02_00242459 predicted 1880
6 SASI_Rn02_00242460 predicted 2176
7 SASI_Rn02_00242461 predicted 1965
8 SASI_Rn02_00242462 predicted 1586
9 SASI_Rn02_00242463 predicted 1105
10 SASI_Rn02_00242464 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020892 predicted 488
2 SASI_Mm01_00020893 predicted 892
3 SASI_Mm01_00020894 predicted 521
4 SASI_Mm01_00020895 predicted 1109
5 SASI_Mm01_00020896 predicted 1005
6 SASI_Mm01_00020897 predicted 1971
7 SASI_Mm01_00020898 predicted 1504
8 SASI_Mm01_00020899 predicted 388
9 SASI_Mm01_00020900 predicted 1727
10 SASI_Mm01_00020901 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006058
TNIP1 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006058.3-1341s21c1
Sequence:CCGGTGATGAGCAATGGCAACAAAGCTCGAGCTTTGTTGCCATTGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006058.3-2681s21c1
Sequence:CCGGCCACCCAGAAGGCTTTCATTTCTCGAGAAATGAAAGCCTTCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006058.2-2554s1c1
Sequence:CCGGCCAATTTGTGTGTGTGTTTAACTCGAGTTAAACACACACACAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-521s1c1
Sequence:CCGGGCTCACAGGAAAGGACTCAAACTCGAGTTTGAGTCCTTTCCTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1230s1c1
Sequence:CCGGCGGTCCATGAAGCAGCAGTATCTCGAGATACTGCTGCTTCATGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1794s1c1
Sequence:CCGGGATGAGGAGAAGGCAAGAGAACTCGAGTTCTCTTGCCTTCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1763s1c1
Sequence:CCGGCCTGTCAAATGCCCAGCTAAACTCGAGTTTAGCTGGGCATTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006058
TNIP1 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006058.3-1341s21c1
Sequence:CCGGTGATGAGCAATGGCAACAAAGCTCGAGCTTTGTTGCCATTGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006058.3-2681s21c1
Sequence:CCGGCCACCCAGAAGGCTTTCATTTCTCGAGAAATGAAAGCCTTCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006058.2-2554s1c1
Sequence:CCGGCCAATTTGTGTGTGTGTTTAACTCGAGTTAAACACACACACAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-521s1c1
Sequence:CCGGGCTCACAGGAAAGGACTCAAACTCGAGTTTGAGTCCTTTCCTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1230s1c1
Sequence:CCGGCGGTCCATGAAGCAGCAGTATCTCGAGATACTGCTGCTTCATGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1794s1c1
Sequence:CCGGGATGAGGAGAAGGCAAGAGAACTCGAGTTCTCTTGCCTTCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1763s1c1
Sequence:CCGGCCTGTCAAATGCCCAGCTAAACTCGAGTTTAGCTGGGCATTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006058
TNIP1 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006058.3-1341s21c1
Sequence:CCGGTGATGAGCAATGGCAACAAAGCTCGAGCTTTGTTGCCATTGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006058.3-2681s21c1
Sequence:CCGGCCACCCAGAAGGCTTTCATTTCTCGAGAAATGAAAGCCTTCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006058.2-2554s1c1
Sequence:CCGGCCAATTTGTGTGTGTGTTTAACTCGAGTTAAACACACACACAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-521s1c1
Sequence:CCGGGCTCACAGGAAAGGACTCAAACTCGAGTTTGAGTCCTTTCCTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1230s1c1
Sequence:CCGGCGGTCCATGAAGCAGCAGTATCTCGAGATACTGCTGCTTCATGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1794s1c1
Sequence:CCGGGATGAGGAGAAGGCAAGAGAACTCGAGTTCTCTTGCCTTCTCCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006058.2-1763s1c1
Sequence:CCGGCCTGTCAAATGCCCAGCTAAACTCGAGTTTAGCTGGGCATTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021327
VALIDATED
TNIP1 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1127s21c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1002s21c1
Sequence:CCGGGCCAGTGTGATGGCGAGTAAACTCGAGTTTACTCGCCATCACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1376s21c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1535s21c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-2374s21c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.2-2084s21c1
Sequence:CCGGTGAGGCTGCAGTGGGTCATTTCTCGAGAAATGACCCACTGCAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-2374s1c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1127s1c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1535s1c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021327.1-192s1c1
Sequence:CCGGGAACGTCTAGTGGAGGAGAATCTCGAGATTCTCCTCCACTAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1376s1c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021327
VALIDATED
TNIP1 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1127s21c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1002s21c1
Sequence:CCGGGCCAGTGTGATGGCGAGTAAACTCGAGTTTACTCGCCATCACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1376s21c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1535s21c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-2374s21c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.2-2084s21c1
Sequence:CCGGTGAGGCTGCAGTGGGTCATTTCTCGAGAAATGACCCACTGCAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-2374s1c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1127s1c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1535s1c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021327.1-192s1c1
Sequence:CCGGGAACGTCTAGTGGAGGAGAATCTCGAGATTCTCCTCCACTAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1376s1c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021327
VALIDATED
TNIP1 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1127s21c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1002s21c1
Sequence:CCGGGCCAGTGTGATGGCGAGTAAACTCGAGTTTACTCGCCATCACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.1-1376s21c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-1535s21c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021327.1-2374s21c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021327.2-2084s21c1
Sequence:CCGGTGAGGCTGCAGTGGGTCATTTCTCGAGAAATGACCCACTGCAGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-2374s1c1
Sequence:CCGGCCTAAGAATGAGGTGCAACAACTCGAGTTGTTGCACCTCATTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1127s1c1
Sequence:CCGGCCGGTCCATGAAGCAGCAGTACTCGAGTACTGCTGCTTCATGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1535s1c1
Sequence:CCGGGTTGCTGAAACAGCAGGTAAACTCGAGTTTACCTGCTGTTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021327.1-192s1c1
Sequence:CCGGGAACGTCTAGTGGAGGAGAATCTCGAGATTCTCCTCCACTAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021327.1-1376s1c1
Sequence:CCGGGCAACGAGAATACCAGGAGAACTCGAGTTCTCCTGGTATTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks