EMAIL THIS PAGE TO A FRIEND

TNIP2

TNFAIP3 interacting protein 2

Synonyms: ABIN2 FLIP1 KLIP
Gene ID:
Human(79155) Summary: TNIP2 binds to the C-terminal zinc finger domain of A20 (TNFAIP3; MIM 191163) and is involved in activation of the ERK (see MAPK3; MIM 601795) MAP kinase pathway in various cell types (Van Huffel et al., 2001 [PubMed 11390377]
Mouse(231130) TNFAIP3 interacting protein 2
Rat(305451) TNFAIP3 interacting protein 2
naked mole-rat(101702872) TNFAIP3 interacting protein 2
domestic guinea pig(100736027) TNFAIP3 interacting protein 2
cow(100336382) TNFAIP3 interacting protein 2
chicken(422884) TNFAIP3 interacting protein 2
domestic cat(101085205) TNFAIP3 interacting protein 2
dog(488798) TNFAIP3 interacting protein 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024309 Rosetta Predictions human pricing
NM_001024771 Rosetta Predictions rat pricing
NM_139064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087959 predicted 1462
2 SASI_Hs01_00087961 predicted 687
3 SASI_Hs01_00087962 predicted 1216
4 SASI_Hs01_00087963 predicted 1031
5 SASI_Hs01_00087964 predicted 1332
6 SASI_Hs02_00356651 predicted 818
7 SASI_Hs01_00087965 predicted 1411
8 SASI_Hs02_00356652 predicted 628
9 SASI_Hs01_00087966 predicted 643
10 SASI_Hs01_00087967 predicted 1402
11 SASI_Hs01_00087958 predicted 1095
12 SASI_Hs01_00087960 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107331 predicted 1092
2 SASI_Rn01_00107332 predicted 386
3 SASI_Rn01_00107335 predicted 873
4 SASI_Rn01_00107337 predicted 786
5 SASI_Rn02_00202658 predicted 698
6 SASI_Rn01_00107338 predicted 611
7 SASI_Rn01_00107339 predicted 595
8 SASI_Rn01_00107340 predicted 1218
9 SASI_Rn02_00202659 predicted 673
10 SASI_Rn02_00202660 predicted 1112
11 SASI_Rn01_00107333 predicted 704
12 SASI_Rn01_00107334 predicted 1211
13 SASI_Rn01_00107336 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192967 predicted 1295
2 SASI_Mm01_00192968 predicted 775
3 SASI_Mm02_00339868 predicted 856
4 SASI_Mm02_00339869 predicted 683
5 SASI_Mm01_00192970 predicted 370
6 SASI_Mm01_00192971 predicted 683
7 SASI_Mm01_00192972 predicted 1210
8 SASI_Mm01_00192973 predicted 450
9 SASI_Mm01_00192974 predicted 966
10 SASI_Mm01_00192975 predicted 975
11 SASI_Mm01_00192969 predicted 998
12 SASI_Mm01_00192976 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024309
VALIDATED
TNIP2 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1751s1c1
Sequence:CCGGGAACCAGTCAAATGGAGTATTCTCGAGAATACTCCATTTGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-642s1c1
Sequence:CCGGCCAGAGTGTTATTGAGAAGTTCTCGAGAACTTCTCAATAACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-963s1c1
Sequence:CCGGCAAGGATGACTTCATGTCAGACTCGAGTCTGACATGAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-934s1c1
Sequence:CCGGCAGATGCTGGAACAGCAGATTCTCGAGAATCTGCTGTTCCAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-319s1c1
Sequence:CCGGCAGGAAATTGAGAGGCTGACTCTCGAGAGTCAGCCTCTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-688s1c1
Sequence:CCGGCAGAAGGTGACTCACGTTGAACTCGAGTTCAACGTGAGTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-1000s1c1
Sequence:CCGGCGGGCTCAAAGTAGGATTCAACTCGAGTTGAATCCTACTTTGAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024309.2-696s1c1
Sequence:CCGGGACTCACGTTGAAGACCTCAACTCGAGTTGAGGTCTTCAACGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-837s1c1
Sequence:CCGGCAACAGACAGTTGGAAGAGAACTCGAGTTCTCTTCCAACTGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1710s1c1
Sequence:CCGGCCCATCCTGTTCTATGGAATACTCGAGTATTCCATAGAACAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-951s1c1
Sequence:CCGGGATTCTCGCTTACAAGGATGACTCGAGTCATCCTTGTAAGCGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1750s1c1
Sequence:CCGGCGAACCAGTCAAATGGAGTATCTCGAGATACTCCATTTGACTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1711s1c1
Sequence:CCGGCCATCCTGTTCTATGGAATAACTCGAGTTATTCCATAGAACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024309
VALIDATED
TNIP2 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1751s1c1
Sequence:CCGGGAACCAGTCAAATGGAGTATTCTCGAGAATACTCCATTTGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-642s1c1
Sequence:CCGGCCAGAGTGTTATTGAGAAGTTCTCGAGAACTTCTCAATAACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-963s1c1
Sequence:CCGGCAAGGATGACTTCATGTCAGACTCGAGTCTGACATGAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-934s1c1
Sequence:CCGGCAGATGCTGGAACAGCAGATTCTCGAGAATCTGCTGTTCCAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-319s1c1
Sequence:CCGGCAGGAAATTGAGAGGCTGACTCTCGAGAGTCAGCCTCTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-688s1c1
Sequence:CCGGCAGAAGGTGACTCACGTTGAACTCGAGTTCAACGTGAGTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-1000s1c1
Sequence:CCGGCGGGCTCAAAGTAGGATTCAACTCGAGTTGAATCCTACTTTGAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024309.2-696s1c1
Sequence:CCGGGACTCACGTTGAAGACCTCAACTCGAGTTGAGGTCTTCAACGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-837s1c1
Sequence:CCGGCAACAGACAGTTGGAAGAGAACTCGAGTTCTCTTCCAACTGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1710s1c1
Sequence:CCGGCCCATCCTGTTCTATGGAATACTCGAGTATTCCATAGAACAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-951s1c1
Sequence:CCGGGATTCTCGCTTACAAGGATGACTCGAGTCATCCTTGTAAGCGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1750s1c1
Sequence:CCGGCGAACCAGTCAAATGGAGTATCTCGAGATACTCCATTTGACTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1711s1c1
Sequence:CCGGCCATCCTGTTCTATGGAATAACTCGAGTTATTCCATAGAACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024309
VALIDATED
TNIP2 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1751s1c1
Sequence:CCGGGAACCAGTCAAATGGAGTATTCTCGAGAATACTCCATTTGACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-642s1c1
Sequence:CCGGCCAGAGTGTTATTGAGAAGTTCTCGAGAACTTCTCAATAACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-963s1c1
Sequence:CCGGCAAGGATGACTTCATGTCAGACTCGAGTCTGACATGAAGTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-934s1c1
Sequence:CCGGCAGATGCTGGAACAGCAGATTCTCGAGAATCTGCTGTTCCAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024309.2-319s1c1
Sequence:CCGGCAGGAAATTGAGAGGCTGACTCTCGAGAGTCAGCCTCTCAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-688s1c1
Sequence:CCGGCAGAAGGTGACTCACGTTGAACTCGAGTTCAACGTGAGTCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-1000s1c1
Sequence:CCGGCGGGCTCAAAGTAGGATTCAACTCGAGTTGAATCCTACTTTGAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024309.2-696s1c1
Sequence:CCGGGACTCACGTTGAAGACCTCAACTCGAGTTGAGGTCTTCAACGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-837s1c1
Sequence:CCGGCAACAGACAGTTGGAAGAGAACTCGAGTTCTCTTCCAACTGTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1710s1c1
Sequence:CCGGCCCATCCTGTTCTATGGAATACTCGAGTATTCCATAGAACAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024309.2-951s1c1
Sequence:CCGGGATTCTCGCTTACAAGGATGACTCGAGTCATCCTTGTAAGCGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024309.2-1750s1c1
Sequence:CCGGCGAACCAGTCAAATGGAGTATCTCGAGATACTCCATTTGACTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122090    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024309.2-1711s1c1
Sequence:CCGGCCATCCTGTTCTATGGAATAACTCGAGTTATTCCATAGAACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139064
TNIP2 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-590s1c1
Sequence:CCGGGCCAAATGTCTGGATGAACGACTCGAGTCGTTCATCCAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-368s1c1
Sequence:CCGGGAAAGACTTACGGAGCGTCTACTCGAGTAGACGCTCCGTAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139064.1-1813s1c1
Sequence:CCGGGCTGCATTACAGTTACATGATCTCGAGATCATGTAACTGTAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1661s21c1
Sequence:CCGGCTATCAGTTGTGGGAATATTCCTCGAGGAATATTCCCACAACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1126s21c1
Sequence:CCGGAGGACCCTGTCGGATTCATACCTCGAGGTATGAATCCGACAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1543s21c1
Sequence:CCGGCTTGGTCAGAGGGAACTATTGCTCGAGCAATAGTTCCCTCTGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-775s21c1
Sequence:CCGGTGATGCAAGTAGGGACGAATACTCGAGTATTCGTCCCTACTTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-676s21c1
Sequence:CCGGTTCTGGCCAGAGTGTTATTAACTCGAGTTAATAACACTCTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-859s21c1
Sequence:CCGGGAAGGAGATTTCCCGACTTAACTCGAGTTAAGTCGGGAAATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1040s21c1
Sequence:CCGGCGAGCGCACAGTAGGATTCAACTCGAGTTGAATCCTACTGTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139064
TNIP2 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-590s1c1
Sequence:CCGGGCCAAATGTCTGGATGAACGACTCGAGTCGTTCATCCAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-368s1c1
Sequence:CCGGGAAAGACTTACGGAGCGTCTACTCGAGTAGACGCTCCGTAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139064.1-1813s1c1
Sequence:CCGGGCTGCATTACAGTTACATGATCTCGAGATCATGTAACTGTAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1661s21c1
Sequence:CCGGCTATCAGTTGTGGGAATATTCCTCGAGGAATATTCCCACAACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1126s21c1
Sequence:CCGGAGGACCCTGTCGGATTCATACCTCGAGGTATGAATCCGACAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1543s21c1
Sequence:CCGGCTTGGTCAGAGGGAACTATTGCTCGAGCAATAGTTCCCTCTGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-775s21c1
Sequence:CCGGTGATGCAAGTAGGGACGAATACTCGAGTATTCGTCCCTACTTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-676s21c1
Sequence:CCGGTTCTGGCCAGAGTGTTATTAACTCGAGTTAATAACACTCTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-859s21c1
Sequence:CCGGGAAGGAGATTTCCCGACTTAACTCGAGTTAAGTCGGGAAATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1040s21c1
Sequence:CCGGCGAGCGCACAGTAGGATTCAACTCGAGTTGAATCCTACTGTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139064
TNIP2 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-590s1c1
Sequence:CCGGGCCAAATGTCTGGATGAACGACTCGAGTCGTTCATCCAGACATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139064.1-368s1c1
Sequence:CCGGGAAAGACTTACGGAGCGTCTACTCGAGTAGACGCTCCGTAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139064.1-1813s1c1
Sequence:CCGGGCTGCATTACAGTTACATGATCTCGAGATCATGTAACTGTAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1661s21c1
Sequence:CCGGCTATCAGTTGTGGGAATATTCCTCGAGGAATATTCCCACAACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1126s21c1
Sequence:CCGGAGGACCCTGTCGGATTCATACCTCGAGGTATGAATCCGACAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139064.2-1543s21c1
Sequence:CCGGCTTGGTCAGAGGGAACTATTGCTCGAGCAATAGTTCCCTCTGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-775s21c1
Sequence:CCGGTGATGCAAGTAGGGACGAATACTCGAGTATTCGTCCCTACTTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-676s21c1
Sequence:CCGGTTCTGGCCAGAGTGTTATTAACTCGAGTTAATAACACTCTGGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-859s21c1
Sequence:CCGGGAAGGAGATTTCCCGACTTAACTCGAGTTAAGTCGGGAAATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139064.2-1040s21c1
Sequence:CCGGCGAGCGCACAGTAGGATTCAACTCGAGTTGAATCCTACTGTGCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks