EMAIL THIS PAGE TO A FRIEND

TNIP3

TNFAIP3 interacting protein 3

Synonyms: ABIN-3 LIND
Gene ID:
Mouse(414084) TNFAIP3 interacting protein 3
Rat(689756) TNFAIP3 interacting protein 3
chicken(771693) TNFAIP3 interacting protein 3
dog(483847) TNFAIP3 interacting protein 3
domestic cat(101091363) TNFAIP3 interacting protein 3
sheep(101114957) TNFAIP3 interacting protein 3
domestic guinea pig(100721460) TNFAIP3 interacting protein 3
naked mole-rat(101715385) TNFAIP3 interacting protein 3
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024873 Rosetta Predictions human pricing
XR_006723 Rosetta Predictions rat pricing
NM_001001495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357466 predicted 689
2 SASI_Hs01_00085585 predicted 1274
3 SASI_Hs01_00085586 predicted 1144
4 SASI_Hs01_00085587 predicted 388
5 SASI_Hs01_00085588 predicted 1283
6 SASI_Hs01_00085589 predicted 1130
7 SASI_Hs01_00085590 predicted 1004
8 SASI_Hs01_00085591 predicted 358
9 SASI_Hs01_00085592 predicted 988
10 SASI_Hs02_00357467 predicted 572
11 SASI_Hs01_00085583 predicted 1146
12 SASI_Hs01_00085584 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00412686 predicted 421
2 SASI_Rn01_00123413 predicted 213
3 SASI_Rn02_00412687 predicted 299
4 SASI_Rn01_00123415 predicted 250
5 SASI_Rn01_00123416 predicted 235
6 SASI_Rn01_00123417 predicted 239
7 SASI_Rn01_00123418 predicted 487
8 SASI_Rn02_00412688 predicted 509
9 SASI_Rn02_00412689 predicted 247
10 SASI_Rn02_00412690 predicted 231
11 SASI_Rn01_00123411 predicted 248
12 SASI_Rn01_00123412 predicted 298
13 SASI_Rn01_00123414 predicted 230
14 SASI_Rn01_00123419 predicted 432
15 SASI_Rn01_00123420 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286175 predicted 356
2 SASI_Mm02_00286176 predicted 354
3 SASI_Mm01_00119471 predicted 825
4 SASI_Mm02_00286177 predicted 827
5 SASI_Mm01_00119472 predicted 536
6 SASI_Mm01_00119474 predicted 744
7 SASI_Mm02_00286178 predicted 374
8 SASI_Mm02_00286179 predicted 605
9 SASI_Mm02_00286180 predicted 545
10 SASI_Mm02_00286181 predicted 266
11 SASI_Mm01_00119467 predicted 824
12 SASI_Mm01_00119468 predicted 899
13 SASI_Mm01_00119469 predicted 748
14 SASI_Mm01_00119470 predicted 777
15 SASI_Mm01_00119473 predicted 655
16 SASI_Mm01_00119475 predicted 392
17 SASI_Mm01_00119476 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001495
TNIP3 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-605s21c1
Sequence:CCGGGTGAAATTAAACGCCTCAATACTCGAGTATTGAGGCGTTTAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1268s21c1
Sequence:CCGGTGCAACACAAATACCACATAACTCGAGTTATGTGGTATTTGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-670s21c1
Sequence:CCGGGAGGACTCAGGGAAGTGTAAACTCGAGTTTACACTTCCCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-268s21c1
Sequence:CCGGAGAAGAAAGGACTTGACAAATCTCGAGATTTGTCAAGTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-357s21c1
Sequence:CCGGGGACCAGCAATTCCGAAATATCTCGAGATATTTCGGAATTGCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1142s21c1
Sequence:CCGGTCTGGTGCTGTGACATTATATCTCGAGATATAATGTCACAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-828s21c1
Sequence:CCGGCGACCTGTAGCATTACGTTAGCTCGAGCTAACGTAATGCTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-648s21c1
Sequence:CCGGCATTGGGAGCTCTTCGCTTTCCTCGAGGAAAGCGAAGAGCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001495
TNIP3 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-605s21c1
Sequence:CCGGGTGAAATTAAACGCCTCAATACTCGAGTATTGAGGCGTTTAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1268s21c1
Sequence:CCGGTGCAACACAAATACCACATAACTCGAGTTATGTGGTATTTGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-670s21c1
Sequence:CCGGGAGGACTCAGGGAAGTGTAAACTCGAGTTTACACTTCCCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-268s21c1
Sequence:CCGGAGAAGAAAGGACTTGACAAATCTCGAGATTTGTCAAGTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-357s21c1
Sequence:CCGGGGACCAGCAATTCCGAAATATCTCGAGATATTTCGGAATTGCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1142s21c1
Sequence:CCGGTCTGGTGCTGTGACATTATATCTCGAGATATAATGTCACAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-828s21c1
Sequence:CCGGCGACCTGTAGCATTACGTTAGCTCGAGCTAACGTAATGCTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-648s21c1
Sequence:CCGGCATTGGGAGCTCTTCGCTTTCCTCGAGGAAAGCGAAGAGCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001495
TNIP3 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-605s21c1
Sequence:CCGGGTGAAATTAAACGCCTCAATACTCGAGTATTGAGGCGTTTAATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1268s21c1
Sequence:CCGGTGCAACACAAATACCACATAACTCGAGTTATGTGGTATTTGTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-670s21c1
Sequence:CCGGGAGGACTCAGGGAAGTGTAAACTCGAGTTTACACTTCCCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-268s21c1
Sequence:CCGGAGAAGAAAGGACTTGACAAATCTCGAGATTTGTCAAGTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-357s21c1
Sequence:CCGGGGACCAGCAATTCCGAAATATCTCGAGATATTTCGGAATTGCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001495.2-1142s21c1
Sequence:CCGGTCTGGTGCTGTGACATTATATCTCGAGATATAATGTCACAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-828s21c1
Sequence:CCGGCGACCTGTAGCATTACGTTAGCTCGAGCTAACGTAATGCTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001495.2-648s21c1
Sequence:CCGGCATTGGGAGCTCTTCGCTTTCCTCGAGGAAAGCGAAGAGCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024873
TNIP3 MISSION shRNA Bacterial Glycerol Stock
TNFAIP3 interacting protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-697s1c1
Sequence:CCGGGCTCTTCAGGATGCCTTGAATCTCGAGATTCAAGGCATCCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-247s1c1
Sequence:CCGGGAAAGTTCTACGGAGCATAAACTCGAGTTTATGCTCCGTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-772s1c1
Sequence:CCGGCATGAGGAGATGAGAACAGAACTCGAGTTCTGTTCTCATCTCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1784s1c1
Sequence:CCGGGCTATTCCTTAGACAGATCATCTCGAGATGATCTGTCTAAGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1709s1c1
Sequence:CCGGCGTAGAATTGAAGAGGTGTATCTCGAGATACACCTCTTCAATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1528s1c1
Sequence:CCGGGCAGGGATATTGTATGTTGATCTCGAGATCAACATACAATATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-1127s1c1
Sequence:CCGGCAGATGTACAACACAAGGCAACTCGAGTTGCCTTGTGTTGTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-709s1c1
Sequence:CCGGGCCTTGAATATCAAGTGTTCACTCGAGTGAACACTTGATATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-811s1c1
Sequence:CCGGCAGGTGCAAATATACGAAGAACTCGAGTTCTTCGTATATTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024873
TNIP3 MISSION shRNA shRNA Plasmid DNA
TNFAIP3 interacting protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-697s1c1
Sequence:CCGGGCTCTTCAGGATGCCTTGAATCTCGAGATTCAAGGCATCCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-247s1c1
Sequence:CCGGGAAAGTTCTACGGAGCATAAACTCGAGTTTATGCTCCGTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-772s1c1
Sequence:CCGGCATGAGGAGATGAGAACAGAACTCGAGTTCTGTTCTCATCTCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1784s1c1
Sequence:CCGGGCTATTCCTTAGACAGATCATCTCGAGATGATCTGTCTAAGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1709s1c1
Sequence:CCGGCGTAGAATTGAAGAGGTGTATCTCGAGATACACCTCTTCAATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1528s1c1
Sequence:CCGGGCAGGGATATTGTATGTTGATCTCGAGATCAACATACAATATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-1127s1c1
Sequence:CCGGCAGATGTACAACACAAGGCAACTCGAGTTGCCTTGTGTTGTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-709s1c1
Sequence:CCGGGCCTTGAATATCAAGTGTTCACTCGAGTGAACACTTGATATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-811s1c1
Sequence:CCGGCAGGTGCAAATATACGAAGAACTCGAGTTCTTCGTATATTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024873
TNIP3 MISSION shRNA Lentiviral Transduction Particles
TNFAIP3 interacting protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-697s1c1
Sequence:CCGGGCTCTTCAGGATGCCTTGAATCTCGAGATTCAAGGCATCCTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-247s1c1
Sequence:CCGGGAAAGTTCTACGGAGCATAAACTCGAGTTTATGCTCCGTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-772s1c1
Sequence:CCGGCATGAGGAGATGAGAACAGAACTCGAGTTCTGTTCTCATCTCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1784s1c1
Sequence:CCGGGCTATTCCTTAGACAGATCATCTCGAGATGATCTGTCTAAGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1709s1c1
Sequence:CCGGCGTAGAATTGAAGAGGTGTATCTCGAGATACACCTCTTCAATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024873.2-1528s1c1
Sequence:CCGGGCAGGGATATTGTATGTTGATCTCGAGATCAACATACAATATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-1127s1c1
Sequence:CCGGCAGATGTACAACACAAGGCAACTCGAGTTGCCTTGTGTTGTACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024873.2-709s1c1
Sequence:CCGGGCCTTGAATATCAAGTGTTCACTCGAGTGAACACTTGATATTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024873.2-811s1c1
Sequence:CCGGCAGGTGCAAATATACGAAGAACTCGAGTTCTTCGTATATTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks