EMAIL THIS PAGE TO A FRIEND

TNK1

tyrosine kinase, non-receptor, 1

UniProtKB ID: Q13470, O95364, Q8IYI4
Gene ID:
Human(8711) Summary: The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(83813) tyrosine kinase, non-receptor, 1
Rat(303247) tyrosine kinase, non-receptor, 1
Horse(100061776) tyrosine kinase, non-receptor, 1
dog(489470) tyrosine kinase, non-receptor, 1
domestic cat(101096181) tyrosine kinase, non-receptor, 1
naked mole-rat(101721050) tyrosine kinase, non-receptor, 1
domestic guinea pig(100735628) tyrosine kinase, non-receptor, 1
cow(510356) tyrosine kinase, non-receptor, 1
sheep(101119833) tyrosine kinase, non-receptor, 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082751 MISSION® esiRNA esiRNA human TNK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003985 Rosetta Predictions human pricing
NM_001107012 Rosetta Predictions rat pricing
NM_031880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336682 predicted 2292
2 SASI_Hs01_00128193 predicted 659
3 SASI_Hs01_00128194 predicted 2330
4 SASI_Hs01_00128195 predicted 1853
5 SASI_Hs01_00128196 predicted 1761
6 SASI_Hs01_00128197 predicted 2386
7 SASI_Hs01_00128198 predicted 1139
8 SASI_Hs02_00336683 predicted 2159
9 SASI_Hs02_00336684 predicted 2504
10 SASI_Hs02_00336685 predicted 249
11 SASI_Hs01_00128191 predicted 2372
12 SASI_Hs01_00128192 predicted 2178
13 SASI_Hs01_00128199 predicted 2409
14 SASI_Hs01_00128200 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224616 predicted 451
2 SASI_Rn02_00224617 predicted 557
3 SASI_Rn02_00224618 predicted 1311
4 SASI_Rn02_00224619 predicted 216
5 SASI_Rn02_00224620 predicted 699
6 SASI_Rn02_00224621 predicted 620
7 SASI_Rn02_00224622 predicted 1596
8 SASI_Rn02_00224623 predicted 1745
9 SASI_Rn02_00224624 predicted 1300
10 SASI_Rn02_00224625 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074552 predicted 1143
2 SASI_Mm01_00074553 predicted 375
3 SASI_Mm01_00074554 predicted 560
4 SASI_Mm01_00074555 predicted 1295
5 SASI_Mm01_00074556 predicted 673
6 SASI_Mm01_00074557 predicted 1450
7 SASI_Mm02_00337195 predicted 1077
8 SASI_Mm01_00074559 predicted 1206
9 SASI_Mm02_00337196 predicted 1796
10 SASI_Mm01_00074560 predicted 2147
11 SASI_Mm01_00074558 predicted 1568
12 SASI_Mm01_00074561 predicted 2253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003985
TNK1 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase, non-receptor, 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.x-2368s1c1
Sequence:CCGGGCCCACTACATTCTCAAACAACTCGAGTTGTTTGAGAATGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-220s1c1
Sequence:CCGGCAGGGCACTTCGACTTTGTAACTCGAGTTACAAAGTCGAAGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1266s1c1
Sequence:CCGGGAAGCATGTTGTGTGAGGGATCTCGAGATCCCTCACACAACATGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1503s1c1
Sequence:CCGGGATCAACACCCAGGAAGCATACTCGAGTATGCTTCCTGGGTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1734s1c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-614s1c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2420s1c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1375s1c1
Sequence:CCGGCAATCTGGAAGGACCAGAATGCTCGAGCATTCTGGTCCTTCCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2358s1c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1884s1c1
Sequence:CCGGGAGTTGCAGAGGAAGATTATGCTCGAGCATAATCTTCCTCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2539s1c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-687s1c1
Sequence:CCGGCCTCTGCAGATGGTGATGGAGCTCGAGCTCCATCACCATCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-243s1c1
Sequence:CCGGCCTGAGGACCTGGACGGCATTCTCGAGAATGCCGTCCAGGTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2567s21c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2448s21c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2386s21c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-658s21c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-1763s21c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003985
TNK1 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase, non-receptor, 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.x-2368s1c1
Sequence:CCGGGCCCACTACATTCTCAAACAACTCGAGTTGTTTGAGAATGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-220s1c1
Sequence:CCGGCAGGGCACTTCGACTTTGTAACTCGAGTTACAAAGTCGAAGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1266s1c1
Sequence:CCGGGAAGCATGTTGTGTGAGGGATCTCGAGATCCCTCACACAACATGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1503s1c1
Sequence:CCGGGATCAACACCCAGGAAGCATACTCGAGTATGCTTCCTGGGTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1734s1c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-614s1c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2420s1c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1375s1c1
Sequence:CCGGCAATCTGGAAGGACCAGAATGCTCGAGCATTCTGGTCCTTCCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2358s1c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1884s1c1
Sequence:CCGGGAGTTGCAGAGGAAGATTATGCTCGAGCATAATCTTCCTCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2539s1c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-687s1c1
Sequence:CCGGCCTCTGCAGATGGTGATGGAGCTCGAGCTCCATCACCATCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-243s1c1
Sequence:CCGGCCTGAGGACCTGGACGGCATTCTCGAGAATGCCGTCCAGGTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2567s21c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2448s21c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2386s21c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-658s21c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-1763s21c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003985
TNK1 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase, non-receptor, 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.x-2368s1c1
Sequence:CCGGGCCCACTACATTCTCAAACAACTCGAGTTGTTTGAGAATGTAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-220s1c1
Sequence:CCGGCAGGGCACTTCGACTTTGTAACTCGAGTTACAAAGTCGAAGTGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1266s1c1
Sequence:CCGGGAAGCATGTTGTGTGAGGGATCTCGAGATCCCTCACACAACATGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1503s1c1
Sequence:CCGGGATCAACACCCAGGAAGCATACTCGAGTATGCTTCCTGGGTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.x-1734s1c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-614s1c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2420s1c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1375s1c1
Sequence:CCGGCAATCTGGAAGGACCAGAATGCTCGAGCATTCTGGTCCTTCCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2358s1c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-1884s1c1
Sequence:CCGGGAGTTGCAGAGGAAGATTATGCTCGAGCATAATCTTCCTCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003985.1-2539s1c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003985.1-687s1c1
Sequence:CCGGCCTCTGCAGATGGTGATGGAGCTCGAGCTCCATCACCATCTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003985.1-243s1c1
Sequence:CCGGCCTGAGGACCTGGACGGCATTCTCGAGAATGCCGTCCAGGTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2567s21c1
Sequence:CCGGGATGATGGAAGCCACCATATTCTCGAGAATATGGTGGCTTCCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2448s21c1
Sequence:CCGGCATATGCAGAGGAAGCTTCTACTCGAGTAGAAGCTTCCTCTGCATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003985.3-2386s21c1
Sequence:CCGGGATCTAGTCTGCCCACTACATCTCGAGATGTAGTGGGCAGACTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-658s21c1
Sequence:CCGGGCGAGAGGTATCGGTCATGATCTCGAGATCATGACCGATACCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003985.3-1763s21c1
Sequence:CCGGCCACCTTTATCCTCTAGCTCTCTCGAGAGAGCTAGAGGATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031880
TNK1 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase, non-receptor, 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1097s1c1
Sequence:CCGGCGTGACACTCTGGGAAATGTTCTCGAGAACATTTCCCAGAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1074s1c1
Sequence:CCGGGCCTCTGATGTGTGGATGTTTCTCGAGAAACATCCACACATCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1794s1c1
Sequence:CCGGCCACCTATTATCTGCAACTCTCTCGAGAGAGTTGCAGATAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-665s1c1
Sequence:CCGGGCGGGAAGTATCTGTCATGATCTCGAGATCATGACAGATACTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1094s21c1
Sequence:CCGGTGGCGTGACACTCTGGGAAATCTCGAGATTTCCCAGAGTGTCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-385s21c1
Sequence:CCGGAGAATTGGGTGTACAAGATACCTCGAGGTATCTTGTACACCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-550s21c1
Sequence:CCGGGTGTTGTACATCGAGGGTTATCTCGAGATAACCCTCGATGTACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1633s21c1
Sequence:CCGGTGCAGAGGATGCGAGGCATTTCTCGAGAAATGCCTCGCATCCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031880
TNK1 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase, non-receptor, 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1097s1c1
Sequence:CCGGCGTGACACTCTGGGAAATGTTCTCGAGAACATTTCCCAGAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1074s1c1
Sequence:CCGGGCCTCTGATGTGTGGATGTTTCTCGAGAAACATCCACACATCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1794s1c1
Sequence:CCGGCCACCTATTATCTGCAACTCTCTCGAGAGAGTTGCAGATAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-665s1c1
Sequence:CCGGGCGGGAAGTATCTGTCATGATCTCGAGATCATGACAGATACTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1094s21c1
Sequence:CCGGTGGCGTGACACTCTGGGAAATCTCGAGATTTCCCAGAGTGTCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-385s21c1
Sequence:CCGGAGAATTGGGTGTACAAGATACCTCGAGGTATCTTGTACACCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-550s21c1
Sequence:CCGGGTGTTGTACATCGAGGGTTATCTCGAGATAACCCTCGATGTACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1633s21c1
Sequence:CCGGTGCAGAGGATGCGAGGCATTTCTCGAGAAATGCCTCGCATCCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031880
TNK1 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase, non-receptor, 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1097s1c1
Sequence:CCGGCGTGACACTCTGGGAAATGTTCTCGAGAACATTTCCCAGAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1074s1c1
Sequence:CCGGGCCTCTGATGTGTGGATGTTTCTCGAGAAACATCCACACATCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-1794s1c1
Sequence:CCGGCCACCTATTATCTGCAACTCTCTCGAGAGAGTTGCAGATAATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031880.2-665s1c1
Sequence:CCGGGCGGGAAGTATCTGTCATGATCTCGAGATCATGACAGATACTTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1094s21c1
Sequence:CCGGTGGCGTGACACTCTGGGAAATCTCGAGATTTCCCAGAGTGTCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-385s21c1
Sequence:CCGGAGAATTGGGTGTACAAGATACCTCGAGGTATCTTGTACACCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-550s21c1
Sequence:CCGGGTGTTGTACATCGAGGGTTATCTCGAGATAACCCTCGATGTACAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031880.2-1633s21c1
Sequence:CCGGTGCAGAGGATGCGAGGCATTTCTCGAGAAATGCCTCGCATCCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks