EMAIL THIS PAGE TO A FRIEND

TNK2

tyrosine kinase, non-receptor, 2

Synonyms: ACK ACK-1 ACK1 p21cdc42Hs
UniProtKB ID: Q07912, Q6ZMQ0, Q8N6U7, Q96H59
Gene ID:
Human(10188) Summary: This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Mouse(51789) tyrosine kinase, non-receptor, 2
Rat(303882) tyrosine kinase, non-receptor, 2
cow(280710) tyrosine kinase, non-receptor, 2
sheep(101122917) tyrosine kinase, non-receptor, 2
domestic guinea pig(100715920) tyrosine kinase, non-receptor, 2
naked mole-rat(101701156) tyrosine kinase, non-receptor, 2
chicken(431014) tyrosine kinase, non-receptor, 2
dog(488025) tyrosine kinase, non-receptor, 2
domestic cat(101098817) tyrosine kinase, non-receptor, 2
Gene Class: Cytoskeleton
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305730 ANTI-ACK1 (CENTER Y284) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306044 ANTI-ACK1 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306384 ANTI-ACK1(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1306531 ANTI-ACK1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4504013 Anti-phospho-ACK1 (pTyr284) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301243 Anti-phospho-ACK1 (pTyr284) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1305580 ANTI-PHOSPHO-ACK1(Y518) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305591 ANTI-PHOSPHO-ACK1(Y826) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
GW21569B Anti-TNK2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1406942 Anti-TNK2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1401511 Anti-TNK2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA041954 Anti-TNK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

ELISA

Product # Description Species Add to Cart
 
RAB0933 Phosphotyrosine TNK2 / Activated CDC42 Kinase 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010938 Rosetta Predictions human pricing
NM_005781 Rosetta Predictions human pricing
NM_001008336 Rosetta Predictions rat pricing
XM_001072701 Rosetta Predictions rat pricing
NM_001110147 Rosetta Predictions mouse pricing
NM_016788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028285 predicted 1341
2 SASI_Hs01_00028286 predicted 541
3 SASI_Hs01_00028287 predicted 3903
4 SASI_Hs01_00028288 predicted 1171
5 SASI_Hs01_00028289 predicted 784
6 SASI_Hs01_00028290 predicted 1398
7 SASI_Hs02_00305931 predicted 572
8 SASI_Hs01_00028291 predicted 915
9 SASI_Hs01_00028292 predicted 1457
10 SASI_Hs01_00028294 predicted 1229
11 SASI_Hs01_00028293 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182112 predicted 1548
2 SASI_Hs01_00182113 predicted 756
3 SASI_Hs01_00182114 predicted 4158
4 SASI_Hs01_00182115 predicted 1380
5 SASI_Hs01_00182116 predicted 993
6 SASI_Hs01_00182117 predicted 1608
7 SASI_Hs02_00340271 predicted 779
8 SASI_Hs01_00182118 predicted 1121
9 SASI_Hs01_00182119 predicted 1670
10 SASI_Hs01_00182121 predicted 1442
11 SASI_Hs01_00182120 predicted 2651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064663 predicted 3406
2 SASI_Rn01_00064664 predicted 1843
3 SASI_Rn01_00064665 predicted 3056
4 SASI_Rn01_00064666 predicted 2297
5 SASI_Rn01_00064668 predicted 2769
6 SASI_Rn01_00064669 predicted 1133
7 SASI_Rn01_00064670 predicted 3342
8 SASI_Rn01_00064671 predicted 1426
9 SASI_Rn01_00064672 predicted 515
10 SASI_Rn02_00199084 predicted 2191
11 SASI_Rn01_00064667 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340169 predicted 417
2 SASI_Rn02_00340170 predicted 1777
3 SASI_Rn02_00340171 predicted 789
4 SASI_Rn02_00340172 predicted 858
5 SASI_Rn02_00340173 predicted 2072
6 SASI_Rn02_00340174 predicted 250
7 SASI_Rn02_00340175 predicted 1308
8 SASI_Rn02_00340176 predicted 1235
9 SASI_Rn02_00340177 predicted 492
10 SASI_Rn02_00340178 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304736 predicted 994
2 SASI_Mm02_00304737 predicted 1668
3 SASI_Mm02_00304738 predicted 1688
4 SASI_Mm02_00304739 predicted 1546
5 SASI_Mm02_00304740 predicted 1079
6 SASI_Mm02_00304741 predicted 2408
7 SASI_Mm02_00304742 predicted 1037
8 SASI_Mm02_00304743 predicted 1320
9 SASI_Mm02_00304744 predicted 569
10 SASI_Mm02_00304745 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323564 predicted 3122
2 SASI_Mm02_00323565 predicted 2996
3 SASI_Mm02_00323566 predicted 1669
4 SASI_Mm01_00082569 predicted 1684
5 SASI_Mm01_00082570 predicted 1550
6 SASI_Mm02_00323567 predicted 1076
7 SASI_Mm01_00082572 predicted 2451
8 SASI_Mm01_00082573 predicted 1038
9 SASI_Mm01_00082574 predicted 1328
10 SASI_Mm01_00082575 predicted 572
11 SASI_Mm01_00082568 predicted 1645
12 SASI_Mm01_00082571 predicted 3359
13 SASI_Mm01_00082576 predicted 841
14 SASI_Mm01_00082577 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016788
VALIDATED
TNK2 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase, non-receptor, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-3002s21c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1787s21c1
Sequence:CCGGGTAGGACCCTTCCCTCGAAATCTCGAGATTTCGAGGGAAGGGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-561s21c1
Sequence:CCGGTTCGAGATGACCTCAACATTACTCGAGTAATGTTGAGGTCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-4136s21c1
Sequence:CCGGTGTGGAGTGTTGGACAGAATGCTCGAGCATTCTGTCCAACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1852s21c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-826s1c1
Sequence:CCGGCGAAACCTCATTCGCTTGTATCTCGAGATACAAGCGAATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-2785s1c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1111s1c1
Sequence:CCGGGACCACTATGTCATGCAAGAACTCGAGTTCTTGCATGACATAGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-2311s1c1
Sequence:CCGGGAGACCAATTACGCCTTTGTACTCGAGTACAAAGGCGTAATTGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1635s1c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016788
VALIDATED
TNK2 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase, non-receptor, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-3002s21c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1787s21c1
Sequence:CCGGGTAGGACCCTTCCCTCGAAATCTCGAGATTTCGAGGGAAGGGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-561s21c1
Sequence:CCGGTTCGAGATGACCTCAACATTACTCGAGTAATGTTGAGGTCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-4136s21c1
Sequence:CCGGTGTGGAGTGTTGGACAGAATGCTCGAGCATTCTGTCCAACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1852s21c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-826s1c1
Sequence:CCGGCGAAACCTCATTCGCTTGTATCTCGAGATACAAGCGAATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-2785s1c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1111s1c1
Sequence:CCGGGACCACTATGTCATGCAAGAACTCGAGTTCTTGCATGACATAGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-2311s1c1
Sequence:CCGGGAGACCAATTACGCCTTTGTACTCGAGTACAAAGGCGTAATTGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1635s1c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016788
VALIDATED
TNK2 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase, non-receptor, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-3002s21c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1787s21c1
Sequence:CCGGGTAGGACCCTTCCCTCGAAATCTCGAGATTTCGAGGGAAGGGTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-561s21c1
Sequence:CCGGTTCGAGATGACCTCAACATTACTCGAGTAATGTTGAGGTCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-4136s21c1
Sequence:CCGGTGTGGAGTGTTGGACAGAATGCTCGAGCATTCTGTCCAACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016788.3-1852s21c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-826s1c1
Sequence:CCGGCGAAACCTCATTCGCTTGTATCTCGAGATACAAGCGAATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-2785s1c1
Sequence:CCGGCCTAAGTATGCCACTCCACAACTCGAGTTGTGGAGTGGCATACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1111s1c1
Sequence:CCGGGACCACTATGTCATGCAAGAACTCGAGTTCTTGCATGACATAGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016788.1-2311s1c1
Sequence:CCGGGAGACCAATTACGCCTTTGTACTCGAGTACAAAGGCGTAATTGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016788.1-1635s1c1
Sequence:CCGGGCCTCTACAGAATAGCTTCATCTCGAGATGAAGCTATTCTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005781
TNK2 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase, non-receptor, 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-3844s1c1
Sequence:CCGGGCGCTGTCCCTGCACACTTTGCTCGAGCAAAGTGTGCAGGGACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-2541s1c1
Sequence:CCGGCCAGACCAACTACGCCTTTGTCTCGAGACAAAGGCGTAGTTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-4173s1c1
Sequence:CCGGGCCTTACCATGGACTTGAATGCTCGAGCATTCAAGTCCATGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1978s1c1
Sequence:CCGGCCGGACAGGATTGACGAACTGCTCGAGCAGTTCGTCAATCCTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1764s1c1
Sequence:CCGGCCAGATGAATGATGTCATCACCTCGAGGTGATGACATCATTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1390s1c1
Sequence:CCGGCATTACGTCATGCAGGAACATCTCGAGATGTTCCTGCATGACGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-650s1c1
Sequence:CCGGCCCACTTTGAGTACGTCAAGACTCGAGTCTTGACGTACTCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-837s1c1
Sequence:CCGGGTCGTGGATGAGTAAGGTGTTCTCGAGAACACCTTACTCATCCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-2064s1c1
Sequence:CCGGTGACGAACTGTATCTGGGAAACTCGAGTTTCCCAGATACAGTTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-1636s1c1
Sequence:CCGGCTGCATAAGATCGACAAGGAGCTCGAGCTCCTTGTCGATCTTATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-3375s1c1
Sequence:CCGGCAACTTCTCCACCAACAACAGCTCGAGCTGTTGTTGGTGGAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005781.x-4413s1c1
Sequence:CCGGTGCTTCCTCTTCCACCCAATTCTCGAGAATTGGGTGGAAGAGGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005781
TNK2 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase, non-receptor, 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-3844s1c1
Sequence:CCGGGCGCTGTCCCTGCACACTTTGCTCGAGCAAAGTGTGCAGGGACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-2541s1c1
Sequence:CCGGCCAGACCAACTACGCCTTTGTCTCGAGACAAAGGCGTAGTTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-4173s1c1
Sequence:CCGGGCCTTACCATGGACTTGAATGCTCGAGCATTCAAGTCCATGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1978s1c1
Sequence:CCGGCCGGACAGGATTGACGAACTGCTCGAGCAGTTCGTCAATCCTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1764s1c1
Sequence:CCGGCCAGATGAATGATGTCATCACCTCGAGGTGATGACATCATTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1390s1c1
Sequence:CCGGCATTACGTCATGCAGGAACATCTCGAGATGTTCCTGCATGACGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-650s1c1
Sequence:CCGGCCCACTTTGAGTACGTCAAGACTCGAGTCTTGACGTACTCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-837s1c1
Sequence:CCGGGTCGTGGATGAGTAAGGTGTTCTCGAGAACACCTTACTCATCCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-2064s1c1
Sequence:CCGGTGACGAACTGTATCTGGGAAACTCGAGTTTCCCAGATACAGTTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-1636s1c1
Sequence:CCGGCTGCATAAGATCGACAAGGAGCTCGAGCTCCTTGTCGATCTTATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-3375s1c1
Sequence:CCGGCAACTTCTCCACCAACAACAGCTCGAGCTGTTGTTGGTGGAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005781.x-4413s1c1
Sequence:CCGGTGCTTCCTCTTCCACCCAATTCTCGAGAATTGGGTGGAAGAGGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005781
TNK2 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase, non-receptor, 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-3844s1c1
Sequence:CCGGGCGCTGTCCCTGCACACTTTGCTCGAGCAAAGTGTGCAGGGACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-2541s1c1
Sequence:CCGGCCAGACCAACTACGCCTTTGTCTCGAGACAAAGGCGTAGTTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005781.4-4173s1c1
Sequence:CCGGGCCTTACCATGGACTTGAATGCTCGAGCATTCAAGTCCATGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1978s1c1
Sequence:CCGGCCGGACAGGATTGACGAACTGCTCGAGCAGTTCGTCAATCCTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1764s1c1
Sequence:CCGGCCAGATGAATGATGTCATCACCTCGAGGTGATGACATCATTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-1390s1c1
Sequence:CCGGCATTACGTCATGCAGGAACATCTCGAGATGTTCCTGCATGACGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.4-650s1c1
Sequence:CCGGCCCACTTTGAGTACGTCAAGACTCGAGTCTTGACGTACTCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-837s1c1
Sequence:CCGGGTCGTGGATGAGTAAGGTGTTCTCGAGAACACCTTACTCATCCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-2064s1c1
Sequence:CCGGTGACGAACTGTATCTGGGAAACTCGAGTTTCCCAGATACAGTTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-1636s1c1
Sequence:CCGGCTGCATAAGATCGACAAGGAGCTCGAGCTCCTTGTCGATCTTATGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005781.x-3375s1c1
Sequence:CCGGCAACTTCTCCACCAACAACAGCTCGAGCTGTTGTTGGTGGAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005781.x-4413s1c1
Sequence:CCGGTGCTTCCTCTTCCACCCAATTCTCGAGAATTGGGTGGAAGAGGAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks