EMAIL THIS PAGE TO A FRIEND

TNKS1BP1

tankyrase 1 binding protein 1, 182kDa

Synonyms: TAB182
UniProtKB ID: Q9C0C2, A7E2F8, Q6PJ35, Q6ZV74
Gene ID:
Mouse(228140) tankyrase 1 binding protein 1
Rat(295707) tankyrase 1 binding protein 1
cow(783548) tankyrase 1 binding protein 1, 182kDa
sheep(101119671) tankyrase 1 binding protein 1, 182kDa
domestic guinea pig(100713725) tankyrase 1 binding protein 1, 182kDa
naked mole-rat(101698099) tankyrase 1 binding protein 1, 182kDa
Zebrafish(497601) tankyrase 1 binding protein 1
Horse(100066914) tankyrase 1 binding protein 1, 182kDa
chicken(423136) tankyrase 1 binding protein 1, 182kDa
dog(483496) tankyrase 1 binding protein 1, 182kDa
domestic cat(101089043) tankyrase 1 binding protein 1, 182kDa
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033396 Rosetta Predictions human pricing
XM_001069984 Rosetta Predictions rat pricing
XM_215763 Rosetta Predictions rat pricing
NM_001081260 Rosetta Predictions mouse pricing
XM_619777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037429 predicted 2770
2 SASI_Hs01_00037430 predicted 3599
3 SASI_Hs01_00037431 predicted 3075
4 SASI_Hs01_00037432 predicted 2828
5 SASI_Hs01_00037433 predicted 1838
6 SASI_Hs01_00037434 predicted 2349
7 SASI_Hs01_00037435 predicted 3565
8 SASI_Hs01_00037436 predicted 1063
9 SASI_Hs01_00037437 predicted 2831
10 SASI_Hs01_00037438 predicted 4109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329995 predicted 3329
2 SASI_Rn02_00329996 predicted 4807
3 SASI_Rn02_00329997 predicted 4965
4 SASI_Rn02_00329998 predicted 2642
5 SASI_Rn02_00329999 predicted 1490
6 SASI_Rn02_00330000 predicted 4954
7 SASI_Rn02_00330001 predicted 3979
8 SASI_Rn02_00330002 predicted 2206
9 SASI_Rn02_00330003 predicted 927
10 SASI_Rn02_00330004 predicted 3670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376185 predicted 3332
2 SASI_Rn02_00376186 predicted 4814
3 SASI_Rn02_00376187 predicted 4957
4 SASI_Rn02_00376188 predicted 2639
5 SASI_Rn02_00376189 predicted 1492
6 SASI_Rn02_00376190 predicted 4956
7 SASI_Rn02_00376191 predicted 3977
8 SASI_Rn02_00376192 predicted 2211
9 SASI_Rn02_00376193 predicted 926
10 SASI_Rn02_00376194 predicted 3663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296737 predicted 2703
2 SASI_Mm02_00296738 predicted 2884
3 SASI_Mm02_00296739 predicted 5004
4 SASI_Mm02_00296740 predicted 1524
5 SASI_Mm02_00296741 predicted 3450
6 SASI_Mm02_00296742 predicted 1038
7 SASI_Mm02_00296743 predicted 3532
8 SASI_Mm02_00296744 predicted 1882
9 SASI_Mm02_00296745 predicted 5125
10 SASI_Mm02_00296746 predicted 4049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235926 predicted 2629
2 SASI_Mm01_00235927 predicted 2813
3 SASI_Mm01_00235928 predicted 503
4 SASI_Mm01_00235929 predicted 4928
5 SASI_Mm01_00235930 predicted 1443
6 SASI_Mm01_00235931 predicted 3384
7 SASI_Mm01_00235932 predicted 964
8 SASI_Mm01_00235933 predicted 3454
9 SASI_Mm01_00235934 predicted 1816
10 SASI_Mm01_00235935 predicted 3970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033396
VALIDATED
TNKS1BP1 MISSION shRNA Bacterial Glycerol Stock
tankyrase 1 binding protein 1, 182kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2837s21c1
Sequence:CCGGGAGATTCTCTGGGTGCTTATGCTCGAGCATAAGCACCCAGAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2871s21c1
Sequence:CCGGCAACGAGCAGGGCCAAGATTTCTCGAGAAATCTTGGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1103s1c1
Sequence:CCGGGATATTTCCAAGCCCTGGATTCTCGAGAATCCAGGGCTTGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2842s1c1
Sequence:CCGGGTTCAGAAAGAGGGATTCCCACTCGAGTGGGAATCCCTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3898s1c1
Sequence:CCGGCCTGAGCTTGAGAGACATGAACTCGAGTTCATGTCTCTCAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-2295s1c1
Sequence:CCGGCAGAGGCTCAAGACTTGTGTACTCGAGTACACAAGTCTTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1089s1c1
Sequence:CCGGCGGAGCTACCTGCTGATATTTCTCGAGAAATATCAGCAGGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3664s1c1
Sequence:CCGGGAGGAGCTATCAGTTTGGCATCTCGAGATGCCAAACTGATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3667s1c1
Sequence:CCGGGAGCTATCAGTTTGGCATCATCTCGAGATGATGCCAAACTGATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2492s1c1
Sequence:CCGGCAGAGTGAATTTGGGATCACACTCGAGTGTGATCCCAAATTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3983s1c1
Sequence:CCGGGACTGGACTTCTGATGTTAATCTCGAGATTAACATCAGAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033396
VALIDATED
TNKS1BP1 MISSION shRNA shRNA Plasmid DNA
tankyrase 1 binding protein 1, 182kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2837s21c1
Sequence:CCGGGAGATTCTCTGGGTGCTTATGCTCGAGCATAAGCACCCAGAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2871s21c1
Sequence:CCGGCAACGAGCAGGGCCAAGATTTCTCGAGAAATCTTGGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1103s1c1
Sequence:CCGGGATATTTCCAAGCCCTGGATTCTCGAGAATCCAGGGCTTGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2842s1c1
Sequence:CCGGGTTCAGAAAGAGGGATTCCCACTCGAGTGGGAATCCCTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3898s1c1
Sequence:CCGGCCTGAGCTTGAGAGACATGAACTCGAGTTCATGTCTCTCAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-2295s1c1
Sequence:CCGGCAGAGGCTCAAGACTTGTGTACTCGAGTACACAAGTCTTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1089s1c1
Sequence:CCGGCGGAGCTACCTGCTGATATTTCTCGAGAAATATCAGCAGGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3664s1c1
Sequence:CCGGGAGGAGCTATCAGTTTGGCATCTCGAGATGCCAAACTGATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3667s1c1
Sequence:CCGGGAGCTATCAGTTTGGCATCATCTCGAGATGATGCCAAACTGATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2492s1c1
Sequence:CCGGCAGAGTGAATTTGGGATCACACTCGAGTGTGATCCCAAATTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3983s1c1
Sequence:CCGGGACTGGACTTCTGATGTTAATCTCGAGATTAACATCAGAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033396
VALIDATED
TNKS1BP1 MISSION shRNA Lentiviral Transduction Particles
tankyrase 1 binding protein 1, 182kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2837s21c1
Sequence:CCGGGAGATTCTCTGGGTGCTTATGCTCGAGCATAAGCACCCAGAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033396.2-2871s21c1
Sequence:CCGGCAACGAGCAGGGCCAAGATTTCTCGAGAAATCTTGGCCCTGCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1103s1c1
Sequence:CCGGGATATTTCCAAGCCCTGGATTCTCGAGAATCCAGGGCTTGGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2842s1c1
Sequence:CCGGGTTCAGAAAGAGGGATTCCCACTCGAGTGGGAATCCCTCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3898s1c1
Sequence:CCGGCCTGAGCTTGAGAGACATGAACTCGAGTTCATGTCTCTCAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-2295s1c1
Sequence:CCGGCAGAGGCTCAAGACTTGTGTACTCGAGTACACAAGTCTTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-1089s1c1
Sequence:CCGGCGGAGCTACCTGCTGATATTTCTCGAGAAATATCAGCAGGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3664s1c1
Sequence:CCGGGAGGAGCTATCAGTTTGGCATCTCGAGATGCCAAACTGATAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033396.1-3667s1c1
Sequence:CCGGGAGCTATCAGTTTGGCATCATCTCGAGATGATGCCAAACTGATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-2492s1c1
Sequence:CCGGCAGAGTGAATTTGGGATCACACTCGAGTGTGATCCCAAATTCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033396.1-3983s1c1
Sequence:CCGGGACTGGACTTCTGATGTTAATCTCGAGATTAACATCAGAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081260
VALIDATED
TNKS1BP1 MISSION shRNA Bacterial Glycerol Stock
tankyrase 1 binding protein 1, 182kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-1514s21c1
Sequence:CCGGGAAGCGGGACAGAGTCTAATTCTCGAGAATTAGACTCTGTCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-691s21c1
Sequence:CCGGCACGATGGCAGCTCTCGATATCTCGAGATATCGAGAGCTGCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-2663s21c1
Sequence:CCGGCTCACTCCATCCACGACAAAGCTCGAGCTTTGTCGTGGATGGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-5413s21c1
Sequence:CCGGAGTGTCTGGGAGGCACATTTACTCGAGTAAATGTGCCTCCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-4997s21c1
Sequence:CCGGGGATGTCCTTGGGCACTAAAGCTCGAGCTTTAGTGCCCAAGGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081260
VALIDATED
TNKS1BP1 MISSION shRNA shRNA Plasmid DNA
tankyrase 1 binding protein 1, 182kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-1514s21c1
Sequence:CCGGGAAGCGGGACAGAGTCTAATTCTCGAGAATTAGACTCTGTCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-691s21c1
Sequence:CCGGCACGATGGCAGCTCTCGATATCTCGAGATATCGAGAGCTGCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-2663s21c1
Sequence:CCGGCTCACTCCATCCACGACAAAGCTCGAGCTTTGTCGTGGATGGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-5413s21c1
Sequence:CCGGAGTGTCTGGGAGGCACATTTACTCGAGTAAATGTGCCTCCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-4997s21c1
Sequence:CCGGGGATGTCCTTGGGCACTAAAGCTCGAGCTTTAGTGCCCAAGGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081260
VALIDATED
TNKS1BP1 MISSION shRNA Lentiviral Transduction Particles
tankyrase 1 binding protein 1, 182kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-1514s21c1
Sequence:CCGGGAAGCGGGACAGAGTCTAATTCTCGAGAATTAGACTCTGTCCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-691s21c1
Sequence:CCGGCACGATGGCAGCTCTCGATATCTCGAGATATCGAGAGCTGCCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081260.2-2663s21c1
Sequence:CCGGCTCACTCCATCCACGACAAAGCTCGAGCTTTGTCGTGGATGGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-5413s21c1
Sequence:CCGGAGTGTCTGGGAGGCACATTTACTCGAGTAAATGTGCCTCCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081260.2-4997s21c1
Sequence:CCGGGGATGTCCTTGGGCACTAAAGCTCGAGCTTTAGTGCCCAAGGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks