EMAIL THIS PAGE TO A FRIEND

TNKS2

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2

Synonyms: ARTD6 PARP-5b PARP-5c PARP5B PARP5C TANK2 TNKL pART6
UniProtKB ID: Q9H2K2, B2RBD3, Q9H8F2, Q9HAS4
Gene ID:
Mouse(74493) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Rat(309512) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
chicken(374253) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Horse(100061968) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
domestic cat(101093147) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
dog(477767) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
naked mole-rat(101723051) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Domestic Rabbit(100340857) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
domestic guinea pig(100719373) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
cow(533901) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
sheep(101103938) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
206 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001000101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001000101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001000101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025235 Rosetta Predictions human pricing
NM_001107607 Rosetta Predictions rat pricing
XM_001000101 Rosetta Predictions mouse pricing
XM_917270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106257 predicted 1607
2 SASI_Hs01_00106258 predicted 3525
3 SASI_Hs02_00358046 predicted 1165
4 SASI_Hs01_00106259 predicted 2918
5 SASI_Hs01_00106260 predicted 2537
6 SASI_Hs01_00106261 predicted 1647
7 SASI_Hs02_00358047 predicted 3164
8 SASI_Hs01_00106262 predicted 2895
9 SASI_Hs02_00358048 predicted 1141
10 SASI_Hs02_00358049 predicted 2935
11 SASI_Hs01_00106263 predicted 3152
12 SASI_Hs01_00106264 predicted 3400
13 SASI_Hs01_00106265 predicted 1665
14 SASI_Hs01_00106266 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230505 predicted 1686
2 SASI_Rn02_00230506 predicted 714
3 SASI_Rn02_00230507 predicted 817
4 SASI_Rn02_00230508 predicted 2041
5 SASI_Rn02_00230509 predicted 2219
6 SASI_Rn02_00230510 predicted 1665
7 SASI_Rn02_00230511 predicted 1701
8 SASI_Rn02_00230512 predicted 1437
9 SASI_Rn02_00230513 predicted 1227
10 SASI_Rn02_00230514 predicted 2847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354607 predicted 2508
2 SASI_Mm02_00354608 predicted 3582
3 SASI_Mm02_00354609 predicted 1939
4 SASI_Mm02_00354610 predicted 3200
5 SASI_Mm02_00354611 predicted 3241
6 SASI_Mm02_00354612 predicted 2542
7 SASI_Mm02_00354613 predicted 2530
8 SASI_Mm02_00354614 predicted 3799
9 SASI_Mm02_00354615 predicted 2130
10 SASI_Mm02_00354616 predicted 2658
11 SASI_Mm01_00213465 predicted 212
12 SASI_Mm01_00213466 predicted 487
13 SASI_Mm01_00213467 predicted 486
14 SASI_Mm01_00213468 predicted 205
15 SASI_Mm01_00213469 predicted 231
16 SASI_Mm01_00213470 predicted 348
17 SASI_Mm01_00213471 predicted 483
18 SASI_Mm01_00213472 predicted 387
19 SASI_Mm01_00213473 predicted 482
20 SASI_Mm01_00213474 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440995 predicted 1828
2 SASI_Mm02_00440996 predicted 2177
3 SASI_Mm02_00440997 predicted 3240
4 SASI_Mm02_00440998 predicted 2857
5 SASI_Mm02_00440999 predicted 2898
6 SASI_Mm02_00441000 predicted 2210
7 SASI_Mm02_00441001 predicted 2192
8 SASI_Mm02_00441002 predicted 3457
9 SASI_Mm02_00441003 predicted 1800
10 SASI_Mm02_00441004 predicted 2324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025235
TNKS2 MISSION shRNA Bacterial Glycerol Stock
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2891s1c1
Sequence:CCGGGCCAGCAGTCTTGACAACTTACTCGAGTAAGTTGTCAAGACTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-770s1c1
Sequence:CCGGGCTGCAATTAAAGGAAAGATTCTCGAGAATCTTTCCTTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-3765s1c1
Sequence:CCGGCCAGTGTAAATGGCCTAGCATCTCGAGATGCTAGGCCATTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2126s1c1
Sequence:CCGGGCAGTAGTTAATGTAGCTGATCTCGAGATCAGCTACATTAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2333s1c1
Sequence:CCGGGCTGCCAAGAAGGGTTGTTTACTCGAGTAAACAACCCTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-1745s21c1
Sequence:CCGGAGGGTATCTCATTAGGTAATTCTCGAGAATTACCTAATGAGATACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2347s21c1
Sequence:CCGGCATTTAGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2958s21c1
Sequence:CCGGTGAGCACCTAATGGATATATTCTCGAGAATATATCCATTAGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2507s21c1
Sequence:CCGGGTGTCAATGCCACGGACAAATCTCGAGATTTGTCCGTGGCATTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025235
TNKS2 MISSION shRNA shRNA Plasmid DNA
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2891s1c1
Sequence:CCGGGCCAGCAGTCTTGACAACTTACTCGAGTAAGTTGTCAAGACTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-770s1c1
Sequence:CCGGGCTGCAATTAAAGGAAAGATTCTCGAGAATCTTTCCTTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-3765s1c1
Sequence:CCGGCCAGTGTAAATGGCCTAGCATCTCGAGATGCTAGGCCATTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2126s1c1
Sequence:CCGGGCAGTAGTTAATGTAGCTGATCTCGAGATCAGCTACATTAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2333s1c1
Sequence:CCGGGCTGCCAAGAAGGGTTGTTTACTCGAGTAAACAACCCTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-1745s21c1
Sequence:CCGGAGGGTATCTCATTAGGTAATTCTCGAGAATTACCTAATGAGATACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2347s21c1
Sequence:CCGGCATTTAGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2958s21c1
Sequence:CCGGTGAGCACCTAATGGATATATTCTCGAGAATATATCCATTAGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2507s21c1
Sequence:CCGGGTGTCAATGCCACGGACAAATCTCGAGATTTGTCCGTGGCATTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025235
TNKS2 MISSION shRNA Lentiviral Transduction Particles
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2891s1c1
Sequence:CCGGGCCAGCAGTCTTGACAACTTACTCGAGTAAGTTGTCAAGACTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-770s1c1
Sequence:CCGGGCTGCAATTAAAGGAAAGATTCTCGAGAATCTTTCCTTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-3765s1c1
Sequence:CCGGCCAGTGTAAATGGCCTAGCATCTCGAGATGCTAGGCCATTTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2126s1c1
Sequence:CCGGGCAGTAGTTAATGTAGCTGATCTCGAGATCAGCTACATTAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025235.2-2333s1c1
Sequence:CCGGGCTGCCAAGAAGGGTTGTTTACTCGAGTAAACAACCCTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-1745s21c1
Sequence:CCGGAGGGTATCTCATTAGGTAATTCTCGAGAATTACCTAATGAGATACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2347s21c1
Sequence:CCGGCATTTAGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2958s21c1
Sequence:CCGGTGAGCACCTAATGGATATATTCTCGAGAATATATCCATTAGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025235.3-2507s21c1
Sequence:CCGGGTGTCAATGCCACGGACAAATCTCGAGATTTGTCCGTGGCATTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001000101
VALIDATED
TNKS2 MISSION shRNA Bacterial Glycerol Stock
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3164s21c1
Sequence:CCGGTTGAGCACTTGATGGATATATCTCGAGATATATCCATCAAGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-2548s21c1
Sequence:CCGGCATTTGGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3268s21c1
Sequence:CCGGCATCGACACAAGCTGATTAAACTCGAGTTTAATCAGCTTGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-845s21c1
Sequence:CCGGACCCAAATGCTCGGGATAATTCTCGAGAATTATCCCGAGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-4424s21c1
Sequence:CCGGTACATCGCTTTGTACTATAAACTCGAGTTTATAGTACAAAGCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001000101
VALIDATED
TNKS2 MISSION shRNA shRNA Plasmid DNA
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3164s21c1
Sequence:CCGGTTGAGCACTTGATGGATATATCTCGAGATATATCCATCAAGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-2548s21c1
Sequence:CCGGCATTTGGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3268s21c1
Sequence:CCGGCATCGACACAAGCTGATTAAACTCGAGTTTAATCAGCTTGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-845s21c1
Sequence:CCGGACCCAAATGCTCGGGATAATTCTCGAGAATTATCCCGAGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-4424s21c1
Sequence:CCGGTACATCGCTTTGTACTATAAACTCGAGTTTATAGTACAAAGCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001000101
VALIDATED
TNKS2 MISSION shRNA Lentiviral Transduction Particles
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3164s21c1
Sequence:CCGGTTGAGCACTTGATGGATATATCTCGAGATATATCCATCAAGTGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-2548s21c1
Sequence:CCGGCATTTGGCAGCTGGTTATAATCTCGAGATTATAACCAGCTGCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-3268s21c1
Sequence:CCGGCATCGACACAAGCTGATTAAACTCGAGTTTAATCAGCTTGTGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-845s21c1
Sequence:CCGGACCCAAATGCTCGGGATAATTCTCGAGAATTATCCCGAGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001000101.2-4424s21c1
Sequence:CCGGTACATCGCTTTGTACTATAAACTCGAGTTTATAGTACAAAGCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks