EMAIL THIS PAGE TO A FRIEND

TNKS

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms: ARTD5 PARP-5a PARP5A PARPL TIN1 TINF1 TNKS1 pART5
UniProtKB ID: O95271, O95272, Q4G0F2
Gene ID:
Mouse(21951) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Rat(290794) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Zebrafish(559022) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
domestic cat(101092933) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
dog(475603) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
chicken(374252) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
naked mole-rat(101719484) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
domestic guinea pig(100728577) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
cow(535030) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
sheep(101103121) tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
266 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003747 Rosetta Predictions human pricing
NM_001106084 Rosetta Predictions rat pricing
NM_175091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164146 predicted 2274
2 SASI_Hs01_00164147 predicted 3301
3 SASI_Hs01_00164148 predicted 3571
4 SASI_Hs01_00164149 predicted 1070
5 SASI_Hs01_00164150 predicted 2034
6 SASI_Hs01_00164151 predicted 3277
7 SASI_Hs02_00336211 predicted 1694
8 SASI_Hs02_00336212 predicted 2053
9 SASI_Hs01_00164152 predicted 3164
10 SASI_Hs01_00164153 predicted 1956
11 SASI_Hs01_00164154 predicted 992
12 SASI_Hs01_00164155 predicted 2613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215472 predicted 1959
2 SASI_Rn02_00215473 predicted 1583
3 SASI_Rn02_00215474 predicted 2433
4 SASI_Rn02_00215475 predicted 1387
5 SASI_Rn02_00215476 predicted 1770
6 SASI_Rn02_00215477 predicted 1529
7 SASI_Rn02_00215478 predicted 2070
8 SASI_Rn02_00215479 predicted 1953
9 SASI_Rn02_00215480 predicted 1376
10 SASI_Rn02_00215481 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092322 predicted 1920
2 SASI_Mm01_00092323 predicted 2560
3 SASI_Mm01_00092324 predicted 1237
4 SASI_Mm01_00092325 predicted 3443
5 SASI_Mm01_00092326 predicted 3162
6 SASI_Mm01_00092327 predicted 1128
7 SASI_Mm01_00092328 predicted 3573
8 SASI_Mm01_00092330 predicted 1082
9 SASI_Mm01_00092331 predicted 2700
10 SASI_Mm02_00345674 predicted 1377
11 SASI_Mm01_00092329 predicted 1449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003747
VALIDATED
TNKS MISSION shRNA Bacterial Glycerol Stock
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-146s1c1
Sequence:CCGGAACTATACACCTCTGCATGACTCGAGTCATGCAGAGGTGTATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-3191s1c1
Sequence:CCGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-760s1c1
Sequence:CCGGCGCTTCATAATGCCTGTTCTTCTCGAGAAGAACAGGCATTATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-3339s1c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1710s1c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-834s1c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1962s1c1
Sequence:CCGGCGACTCTTAGAGGCATCTAAACTCGAGTTTAGATGCCTCTAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3895s21c1
Sequence:CCGGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3339s21c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003747.2-4487s21c1
Sequence:CCGGAGAGCCTTCTTGAGGATATTTCTCGAGAAATATCCTCAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-834s21c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-1710s21c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003747
VALIDATED
TNKS MISSION shRNA shRNA Plasmid DNA
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-146s1c1
Sequence:CCGGAACTATACACCTCTGCATGACTCGAGTCATGCAGAGGTGTATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-3191s1c1
Sequence:CCGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-760s1c1
Sequence:CCGGCGCTTCATAATGCCTGTTCTTCTCGAGAAGAACAGGCATTATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-3339s1c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1710s1c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-834s1c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1962s1c1
Sequence:CCGGCGACTCTTAGAGGCATCTAAACTCGAGTTTAGATGCCTCTAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3895s21c1
Sequence:CCGGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3339s21c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003747.2-4487s21c1
Sequence:CCGGAGAGCCTTCTTGAGGATATTTCTCGAGAAATATCCTCAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-834s21c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-1710s21c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003747
VALIDATED
TNKS MISSION shRNA Lentiviral Transduction Particles
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-146s1c1
Sequence:CCGGAACTATACACCTCTGCATGACTCGAGTCATGCAGAGGTGTATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.x-3191s1c1
Sequence:CCGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-760s1c1
Sequence:CCGGCGCTTCATAATGCCTGTTCTTCTCGAGAAGAACAGGCATTATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-3339s1c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1710s1c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-834s1c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003747.1-1962s1c1
Sequence:CCGGCGACTCTTAGAGGCATCTAAACTCGAGTTTAGATGCCTCTAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3895s21c1
Sequence:CCGGGAGAACAGGCATACCCAGAGTCTCGAGACTCTGGGTATGCCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-3339s21c1
Sequence:CCGGGCTCCAGAAGATAAAGAATATCTCGAGATATTCTTTATCTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003747.2-4487s21c1
Sequence:CCGGAGAGCCTTCTTGAGGATATTTCTCGAGAAATATCCTCAAGAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-834s21c1
Sequence:CCGGGCCAGGGATAACTGGAACTATCTCGAGATAGTTCCAGTTATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003747.2-1710s21c1
Sequence:CCGGGCCCATAATGATGTCATGGAACTCGAGTTCCATGACATCATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175091
VALIDATED
TNKS MISSION shRNA Bacterial Glycerol Stock
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000111415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-1326s1c1
Sequence:CCGGCGTCTCTTAGAGGCATCGAAACTCGAGTTTCGATGCCTCTAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2528s1c1
Sequence:CCGGGCTAGATGTGTTGGCTGATATCTCGAGATATCAGCCAACACATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2061s1c1
Sequence:CCGGGCAACGGATAAGTGGGCCTTTCTCGAGAAAGGCCCACTTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-594s1c1
Sequence:CCGGGCATGCTCATACGGACACTATCTCGAGATAGTGTCCGTATGAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175091
VALIDATED
TNKS MISSION shRNA shRNA Plasmid DNA
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000111415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-1326s1c1
Sequence:CCGGCGTCTCTTAGAGGCATCGAAACTCGAGTTTCGATGCCTCTAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2528s1c1
Sequence:CCGGGCTAGATGTGTTGGCTGATATCTCGAGATATCAGCCAACACATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2061s1c1
Sequence:CCGGGCAACGGATAAGTGGGCCTTTCTCGAGAAAGGCCCACTTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-594s1c1
Sequence:CCGGGCATGCTCATACGGACACTATCTCGAGATAGTGTCCGTATGAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175091
VALIDATED
TNKS MISSION shRNA Lentiviral Transduction Particles
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000111415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-1326s1c1
Sequence:CCGGCGTCTCTTAGAGGCATCGAAACTCGAGTTTCGATGCCTCTAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2528s1c1
Sequence:CCGGGCTAGATGTGTTGGCTGATATCTCGAGATATCAGCCAACACATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-2061s1c1
Sequence:CCGGGCAACGGATAAGTGGGCCTTTCTCGAGAAAGGCCCACTTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175091.2-594s1c1
Sequence:CCGGGCATGCTCATACGGACACTATCTCGAGATAGTGTCCGTATGAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks