EMAIL THIS PAGE TO A FRIEND

TNMD

tenomodulin

Synonyms: BRICD4 CHM1L TEM
UniProtKB ID: Q9H2S6, Q9HBX0, Q9UJG0
Gene ID:
Human(64102) Summary: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]
Mouse(64103) tenomodulin
Rat(64104) tenomodulin
Zebrafish(556984) tenomodulin
dog(480980) tenomodulin
Horse(100033840) tenomodulin
chicken(404530) tenomodulin
cow(781292) tenomodulin
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022144 Rosetta Predictions human pricing
NM_022290 Rosetta Predictions rat pricing
NM_022322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234285 predicted 549
2 SASI_Hs01_00234286 predicted 548
3 SASI_Hs01_00234289 predicted 335
4 SASI_Hs01_00234287 predicted 498
5 SASI_Hs01_00234288 predicted 1115
6 SASI_Hs02_00355556 predicted 417
7 SASI_Hs02_00355557 predicted 559
8 SASI_Hs02_00355558 predicted 514
9 SASI_Hs01_00234291 predicted 404
10 SASI_Hs01_00234292 predicted 372
11 SASI_Hs01_00234290 predicted 410
12 SASI_Hs01_00234293 predicted 468
13 SASI_Hs01_00234294 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110989 predicted 285
2 SASI_Rn01_00110990 predicted 538
3 SASI_Rn01_00110991 predicted 512
4 SASI_Rn01_00110992 predicted 589
5 SASI_Rn01_00110993 predicted 322
6 SASI_Rn02_00263108 predicted 474
7 SASI_Rn01_00110994 predicted 546
8 SASI_Rn01_00110996 predicted 493
9 SASI_Rn01_00110997 predicted 395
10 SASI_Rn01_00110998 predicted 412
11 SASI_Rn01_00110995 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171589 predicted 622
2 SASI_Mm01_00171590 predicted 922
3 SASI_Mm01_00171591 predicted 570
4 SASI_Mm01_00171592 predicted 304
5 SASI_Mm01_00171593 predicted 492
6 SASI_Mm01_00171594 predicted 527
7 SASI_Mm01_00171595 predicted 374
8 SASI_Mm01_00171596 predicted 311
9 SASI_Mm01_00171597 predicted 751
10 SASI_Mm02_00326556 predicted 791
11 SASI_Mm01_00171598 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022322
TNMD MISSION shRNA Bacterial Glycerol Stock
tenomodulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022322.2-1169s1c1
Sequence:CCGGCAAACGCTTAACCTTCTGTTACTCGAGTAACAGAAGGTTAAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-751s1c1
Sequence:CCGGCTGGATCAATCCCACTCTAATCTCGAGATTAGAGTGGGATTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-982s1c1
Sequence:CCGGGAGAGGTTACTGTTGTATTTACTCGAGTAAATACAACAGTAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-254s1c1
Sequence:CCGGGCTCTGAAATCTAAGAAGATACTCGAGTATCTTCTTAGATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-381s1c1
Sequence:CCGGCCTATGACATGGAGCACACTTCTCGAGAAGTGTGCTCCATGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022322
TNMD MISSION shRNA shRNA Plasmid DNA
tenomodulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022322.2-1169s1c1
Sequence:CCGGCAAACGCTTAACCTTCTGTTACTCGAGTAACAGAAGGTTAAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-751s1c1
Sequence:CCGGCTGGATCAATCCCACTCTAATCTCGAGATTAGAGTGGGATTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-982s1c1
Sequence:CCGGGAGAGGTTACTGTTGTATTTACTCGAGTAAATACAACAGTAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-254s1c1
Sequence:CCGGGCTCTGAAATCTAAGAAGATACTCGAGTATCTTCTTAGATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-381s1c1
Sequence:CCGGCCTATGACATGGAGCACACTTCTCGAGAAGTGTGCTCCATGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022322
TNMD MISSION shRNA Lentiviral Transduction Particles
tenomodulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022322.2-1169s1c1
Sequence:CCGGCAAACGCTTAACCTTCTGTTACTCGAGTAACAGAAGGTTAAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-751s1c1
Sequence:CCGGCTGGATCAATCCCACTCTAATCTCGAGATTAGAGTGGGATTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-982s1c1
Sequence:CCGGGAGAGGTTACTGTTGTATTTACTCGAGTAAATACAACAGTAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-254s1c1
Sequence:CCGGGCTCTGAAATCTAAGAAGATACTCGAGTATCTTCTTAGATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022322.2-381s1c1
Sequence:CCGGCCTATGACATGGAGCACACTTCTCGAGAAGTGTGCTCCATGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022144
TNMD MISSION shRNA Bacterial Glycerol Stock
tenomodulin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-507s1c1
Sequence:CCGGCGGATACACTGGCATCTACTTCTCGAGAAGTAGATGCCAGTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-559s1c1
Sequence:CCGGCAGATTAAAGTGATTCCTGAACTCGAGTTCAGGAATCACTTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-595s1c1
Sequence:CCGGGAGGAAATAGATGAGAATGAACTCGAGTTCATTCTCATCTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-763s1c1
Sequence:CCGGGTTTCTGAGTTACAAGACTTTCTCGAGAAAGTCTTGTAACTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-967s1c1
Sequence:CCGGGAGAGAGGTTATTGTTGTATTCTCGAGAATACAACAATAACCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-306s1c1
Sequence:CCGGCCTAACTCTAATTGTCCTGTTCTCGAGAACAGGACAATTAGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-726s1c1
Sequence:CCGGCGTGACCATGTATTGGATCAACTCGAGTTGATCCAATACATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-305s1c1
Sequence:CCGGCCCTAACTCTAATTGTCCTGTCTCGAGACAGGACAATTAGAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-858s1c1
Sequence:CCGGCCCTCAAGTGAAAGTAGAGAACTCGAGTTCTCTACTTTCACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1048s1c1
Sequence:CCGGCCATATCCATACTGCTACCAACTCGAGTTGGTAGCAGTATGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1018s1c1
Sequence:CCGGCGCGTCTGTGAACCTTTACTACTCGAGTAGTAAAGGTTCACAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022144
TNMD MISSION shRNA shRNA Plasmid DNA
tenomodulin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-507s1c1
Sequence:CCGGCGGATACACTGGCATCTACTTCTCGAGAAGTAGATGCCAGTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-559s1c1
Sequence:CCGGCAGATTAAAGTGATTCCTGAACTCGAGTTCAGGAATCACTTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-595s1c1
Sequence:CCGGGAGGAAATAGATGAGAATGAACTCGAGTTCATTCTCATCTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-763s1c1
Sequence:CCGGGTTTCTGAGTTACAAGACTTTCTCGAGAAAGTCTTGTAACTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-967s1c1
Sequence:CCGGGAGAGAGGTTATTGTTGTATTCTCGAGAATACAACAATAACCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-306s1c1
Sequence:CCGGCCTAACTCTAATTGTCCTGTTCTCGAGAACAGGACAATTAGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-726s1c1
Sequence:CCGGCGTGACCATGTATTGGATCAACTCGAGTTGATCCAATACATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-305s1c1
Sequence:CCGGCCCTAACTCTAATTGTCCTGTCTCGAGACAGGACAATTAGAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-858s1c1
Sequence:CCGGCCCTCAAGTGAAAGTAGAGAACTCGAGTTCTCTACTTTCACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1048s1c1
Sequence:CCGGCCATATCCATACTGCTACCAACTCGAGTTGGTAGCAGTATGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1018s1c1
Sequence:CCGGCGCGTCTGTGAACCTTTACTACTCGAGTAGTAAAGGTTCACAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022144
TNMD MISSION shRNA Lentiviral Transduction Particles
tenomodulin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-507s1c1
Sequence:CCGGCGGATACACTGGCATCTACTTCTCGAGAAGTAGATGCCAGTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-559s1c1
Sequence:CCGGCAGATTAAAGTGATTCCTGAACTCGAGTTCAGGAATCACTTTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-595s1c1
Sequence:CCGGGAGGAAATAGATGAGAATGAACTCGAGTTCATTCTCATCTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-763s1c1
Sequence:CCGGGTTTCTGAGTTACAAGACTTTCTCGAGAAAGTCTTGTAACTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-967s1c1
Sequence:CCGGGAGAGAGGTTATTGTTGTATTCTCGAGAATACAACAATAACCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022144.1-306s1c1
Sequence:CCGGCCTAACTCTAATTGTCCTGTTCTCGAGAACAGGACAATTAGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-726s1c1
Sequence:CCGGCGTGACCATGTATTGGATCAACTCGAGTTGATCCAATACATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-305s1c1
Sequence:CCGGCCCTAACTCTAATTGTCCTGTCTCGAGACAGGACAATTAGAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-858s1c1
Sequence:CCGGCCCTCAAGTGAAAGTAGAGAACTCGAGTTCTCTACTTTCACTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1048s1c1
Sequence:CCGGCCATATCCATACTGCTACCAACTCGAGTTGGTAGCAGTATGGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022144.1-1018s1c1
Sequence:CCGGCGCGTCTGTGAACCTTTACTACTCGAGTAGTAAAGGTTCACAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks