EMAIL THIS PAGE TO A FRIEND

TNN

tenascin N

Synonyms: TN-W
UniProtKB ID: Q9UQP3, B9EGP3, Q5R360
Gene ID:
Mouse(329278) tenascin N
Rat(304913) tenascin N
cow(517433) tenascin N
sheep(101116748) tenascin N
chicken(424435) tenascin N
Horse(100061556) tenascin N
dog(490335) tenascin N
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022093 Rosetta Predictions human pricing
NM_001107189 Rosetta Predictions rat pricing
NM_177839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042472 predicted 3594
2 SASI_Hs01_00042473 predicted 1431
3 SASI_Hs01_00042475 predicted 1709
4 SASI_Hs01_00042476 predicted 1447
5 SASI_Hs01_00042477 predicted 3776
6 SASI_Hs01_00042478 predicted 3037
7 SASI_Hs01_00042479 predicted 3753
8 SASI_Hs01_00042480 predicted 1998
9 SASI_Hs01_00042481 predicted 3532
10 SASI_Hs02_00355478 predicted 918
11 SASI_Hs01_00042474 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226385 predicted 2083
2 SASI_Rn02_00226386 predicted 2050
3 SASI_Rn02_00226387 predicted 2511
4 SASI_Rn02_00226388 predicted 1930
5 SASI_Rn02_00226389 predicted 2525
6 SASI_Rn02_00226390 predicted 1536
7 SASI_Rn02_00226391 predicted 1196
8 SASI_Rn02_00226392 predicted 1469
9 SASI_Rn02_00226393 predicted 1451
10 SASI_Rn02_00226394 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075291 predicted 4348
2 SASI_Mm01_00075292 predicted 795
3 SASI_Mm01_00075293 predicted 4499
4 SASI_Mm01_00075294 predicted 829
5 SASI_Mm01_00075295 predicted 4580
6 SASI_Mm01_00075296 predicted 1500
7 SASI_Mm01_00075297 predicted 1672
8 SASI_Mm01_00075298 predicted 4378
9 SASI_Mm01_00075299 predicted 1410
10 SASI_Mm01_00075300 predicted 3759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022093
TNN MISSION shRNA Bacterial Glycerol Stock
tenascin N
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1079s1c1
Sequence:CCGGGCCTGGAACCAAGTACATAGTCTCGAGACTATGTACTTGGTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3119s1c1
Sequence:CCGGCTACATTCTGACTTACCAGTTCTCGAGAACTGGTAAGTCAGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1515s1c1
Sequence:CCGGGCTGTCATAGACAAGTATGTACTCGAGTACATACTTGTCTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3066s1c1
Sequence:CCGGACGCAGTCTGGTGGCATATTGCTCGAGCAATATGCCACCAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022093
TNN MISSION shRNA shRNA Plasmid DNA
tenascin N
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1079s1c1
Sequence:CCGGGCCTGGAACCAAGTACATAGTCTCGAGACTATGTACTTGGTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3119s1c1
Sequence:CCGGCTACATTCTGACTTACCAGTTCTCGAGAACTGGTAAGTCAGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1515s1c1
Sequence:CCGGGCTGTCATAGACAAGTATGTACTCGAGTACATACTTGTCTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3066s1c1
Sequence:CCGGACGCAGTCTGGTGGCATATTGCTCGAGCAATATGCCACCAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022093
TNN MISSION shRNA Lentiviral Transduction Particles
tenascin N
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1079s1c1
Sequence:CCGGGCCTGGAACCAAGTACATAGTCTCGAGACTATGTACTTGGTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3119s1c1
Sequence:CCGGCTACATTCTGACTTACCAGTTCTCGAGAACTGGTAAGTCAGAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-1515s1c1
Sequence:CCGGGCTGTCATAGACAAGTATGTACTCGAGTACATACTTGTCTATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022093.1-3066s1c1
Sequence:CCGGACGCAGTCTGGTGGCATATTGCTCGAGCAATATGCCACCAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177839
TNN MISSION shRNA Bacterial Glycerol Stock
tenascin N
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177839.2-5004s1c1
Sequence:CCGGGCCAACAATGTTGTAACTGAACTCGAGTTCAGTTACAACATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-4364s1c1
Sequence:CCGGGCAGACTTACAGACTTTCAATCTCGAGATTGAAAGTCTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3872s1c1
Sequence:CCGGGCTCAAATTGATGGCTACATTCTCGAGAATGTAGCCATCAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-1333s1c1
Sequence:CCGGGCAGCCTGGAACGGAATATAACTCGAGTTATATTCCGTTCCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3873s1c1
Sequence:CCGGCTCAAATTGATGGCTACATTTCTCGAGAAATGTAGCCATCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177839
TNN MISSION shRNA shRNA Plasmid DNA
tenascin N
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177839.2-5004s1c1
Sequence:CCGGGCCAACAATGTTGTAACTGAACTCGAGTTCAGTTACAACATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-4364s1c1
Sequence:CCGGGCAGACTTACAGACTTTCAATCTCGAGATTGAAAGTCTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3872s1c1
Sequence:CCGGGCTCAAATTGATGGCTACATTCTCGAGAATGTAGCCATCAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-1333s1c1
Sequence:CCGGGCAGCCTGGAACGGAATATAACTCGAGTTATATTCCGTTCCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3873s1c1
Sequence:CCGGCTCAAATTGATGGCTACATTTCTCGAGAAATGTAGCCATCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177839
TNN MISSION shRNA Lentiviral Transduction Particles
tenascin N
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177839.2-5004s1c1
Sequence:CCGGGCCAACAATGTTGTAACTGAACTCGAGTTCAGTTACAACATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-4364s1c1
Sequence:CCGGGCAGACTTACAGACTTTCAATCTCGAGATTGAAAGTCTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3872s1c1
Sequence:CCGGGCTCAAATTGATGGCTACATTCTCGAGAATGTAGCCATCAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-1333s1c1
Sequence:CCGGGCAGCCTGGAACGGAATATAACTCGAGTTATATTCCGTTCCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177839.2-3873s1c1
Sequence:CCGGCTCAAATTGATGGCTACATTTCTCGAGAAATGTAGCCATCAATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks