EMAIL THIS PAGE TO A FRIEND

TNNC1

troponin C type 1 (slow)

Synonyms: CMD1Z CMH13 TN-C TNC TNNC
UniProtKB ID: P63316, O14800, P02590, P04463
Gene ID:
Human(7134) Summary: Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]
Mouse(21924) troponin C, cardiac/slow skeletal
Rat(290561) troponin C type 1 (slow)
chicken(396032) troponin C type 1 (slow)
domestic cat(101082986) troponin C type 1 (slow)
dog(476595) troponin C type 1 (slow)
cow(509486) troponin C type 1 (slow)
sheep(101111132) troponin C type 1 (slow)
Goat(100860954) troponin C type 1 (slow)
domestic guinea pig(100730526) troponin C type 1 (slow)
naked mole-rat(101702386) troponin C type 1 (slow)
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0735 AQUA Peptide NADGYIDLDEL[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003280 Rosetta Predictions human pricing
NM_001034105 Rosetta Predictions rat pricing
NM_009393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010571 predicted 315
2 SASI_Hs01_00010572 predicted 317
3 SASI_Hs01_00010573 predicted 324
4 SASI_Hs01_00010574 predicted 392
5 SASI_Hs01_00010575 predicted 276
6 SASI_Hs01_00010576 predicted 356
7 SASI_Hs01_00010577 predicted 310
8 SASI_Hs01_00010578 predicted 403
9 SASI_Hs01_00010579 predicted 257
10 SASI_Hs01_00010580 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032350 predicted 214
2 SASI_Rn01_00032351 predicted 207
3 SASI_Rn01_00032352 predicted 217
4 SASI_Rn01_00032353 predicted 202
5 SASI_Rn01_00032354 predicted 256
6 SASI_Rn01_00032355 predicted 218
7 SASI_Rn01_00032356 predicted 197
8 SASI_Rn01_00032357 predicted 243
9 SASI_Rn01_00032358 predicted 211
10 SASI_Rn02_00203940 predicted 241
11 SASI_Rn01_00032359 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127442 predicted 327
2 SASI_Mm01_00127443 predicted 356
3 SASI_Mm01_00127444 predicted 410
4 SASI_Mm01_00127445 predicted 475
5 SASI_Mm01_00127446 predicted 333
6 SASI_Mm01_00127447 predicted 354
7 SASI_Mm01_00127448 predicted 417
8 SASI_Mm01_00127449 predicted 252
9 SASI_Mm01_00127450 predicted 334
10 SASI_Mm02_00316013 predicted 216
11 SASI_Mm01_00127451 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003280
TNNC1 MISSION shRNA Bacterial Glycerol Stock
troponin C type 1 (slow)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-201s21c1
Sequence:CCGGGAGATGATCGATGAGGTGGACCTCGAGGTCCACCTCATCGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-419s21c1
Sequence:CCGGCGACATCGAGGAGCTCATGAACTCGAGTTCATGAGCTCCTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-491s21c1
Sequence:CCGGGTTCATGAAGGGTGTGGAGTACTCGAGTACTCCACACCCTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003280.2-521s21c1
Sequence:CCGGCTTCACCCAGAGCTGCCTATGCTCGAGCATAGGCAGCTCTGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-319s1c1
Sequence:CCGGTCTGACCTCTTCCGCATGTTTCTCGAGAAACATGCGGAAGAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-58s1c1
Sequence:CCGGCAGCTGACAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTGTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-465s1c1
Sequence:CCGGCCGCATCGACTATGATGAGTTCTCGAGAACTCATCATAGTCGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-277s1c1
Sequence:CCGGTGCATGAAGGACGACAGCAAACTCGAGTTTGCTGTCGTCCTTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-366s1c1
Sequence:CCGGCCTGGATGAGCTGAAGATAATCTCGAGATTATCTTCAGCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003280
TNNC1 MISSION shRNA shRNA Plasmid DNA
troponin C type 1 (slow)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-201s21c1
Sequence:CCGGGAGATGATCGATGAGGTGGACCTCGAGGTCCACCTCATCGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-419s21c1
Sequence:CCGGCGACATCGAGGAGCTCATGAACTCGAGTTCATGAGCTCCTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-491s21c1
Sequence:CCGGGTTCATGAAGGGTGTGGAGTACTCGAGTACTCCACACCCTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003280.2-521s21c1
Sequence:CCGGCTTCACCCAGAGCTGCCTATGCTCGAGCATAGGCAGCTCTGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-319s1c1
Sequence:CCGGTCTGACCTCTTCCGCATGTTTCTCGAGAAACATGCGGAAGAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-58s1c1
Sequence:CCGGCAGCTGACAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTGTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-465s1c1
Sequence:CCGGCCGCATCGACTATGATGAGTTCTCGAGAACTCATCATAGTCGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-277s1c1
Sequence:CCGGTGCATGAAGGACGACAGCAAACTCGAGTTTGCTGTCGTCCTTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-366s1c1
Sequence:CCGGCCTGGATGAGCTGAAGATAATCTCGAGATTATCTTCAGCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003280
TNNC1 MISSION shRNA Lentiviral Transduction Particles
troponin C type 1 (slow)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-201s21c1
Sequence:CCGGGAGATGATCGATGAGGTGGACCTCGAGGTCCACCTCATCGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-419s21c1
Sequence:CCGGCGACATCGAGGAGCTCATGAACTCGAGTTCATGAGCTCCTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003280.2-491s21c1
Sequence:CCGGGTTCATGAAGGGTGTGGAGTACTCGAGTACTCCACACCCTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003280.2-521s21c1
Sequence:CCGGCTTCACCCAGAGCTGCCTATGCTCGAGCATAGGCAGCTCTGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-319s1c1
Sequence:CCGGTCTGACCTCTTCCGCATGTTTCTCGAGAAACATGCGGAAGAGGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-58s1c1
Sequence:CCGGCAGCTGACAGAAGAGCAGAAACTCGAGTTTCTGCTCTTCTGTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-465s1c1
Sequence:CCGGCCGCATCGACTATGATGAGTTCTCGAGAACTCATCATAGTCGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-277s1c1
Sequence:CCGGTGCATGAAGGACGACAGCAAACTCGAGTTTGCTGTCGTCCTTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003280.1-366s1c1
Sequence:CCGGCCTGGATGAGCTGAAGATAATCTCGAGATTATCTTCAGCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009393
VALIDATED
TNNC1 MISSION shRNA Bacterial Glycerol Stock
troponin C type 1 (slow)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-481s1c1
Sequence:CCGGCCGAATTGACTATGACGAGTTCTCGAGAACTCGTCATAGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-334s1c1
Sequence:CCGGGTCGGATCTCTTCCGCATGTTCTCGAGAACATGCGGAAGAGATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-254s1c1
Sequence:CCGGACAGTGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-215s1c1
Sequence:CCGGCAGGAGATGATCGACGAAGTACTCGAGTACTTCGTCGATCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-413s1c1
Sequence:CCGGACAGGTGAGACCATTACGGAACTCGAGTTCCGTAATGGTCTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009393
VALIDATED
TNNC1 MISSION shRNA shRNA Plasmid DNA
troponin C type 1 (slow)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-481s1c1
Sequence:CCGGCCGAATTGACTATGACGAGTTCTCGAGAACTCGTCATAGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-334s1c1
Sequence:CCGGGTCGGATCTCTTCCGCATGTTCTCGAGAACATGCGGAAGAGATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-254s1c1
Sequence:CCGGACAGTGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-215s1c1
Sequence:CCGGCAGGAGATGATCGACGAAGTACTCGAGTACTTCGTCGATCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-413s1c1
Sequence:CCGGACAGGTGAGACCATTACGGAACTCGAGTTCCGTAATGGTCTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009393
VALIDATED
TNNC1 MISSION shRNA Lentiviral Transduction Particles
troponin C type 1 (slow)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-481s1c1
Sequence:CCGGCCGAATTGACTATGACGAGTTCTCGAGAACTCGTCATAGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-334s1c1
Sequence:CCGGGTCGGATCTCTTCCGCATGTTCTCGAGAACATGCGGAAGAGATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-254s1c1
Sequence:CCGGACAGTGGACTTCGATGAGTTTCTCGAGAAACTCATCGAAGTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009393.1-215s1c1
Sequence:CCGGCAGGAGATGATCGACGAAGTACTCGAGTACTTCGTCGATCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009393.1-413s1c1
Sequence:CCGGACAGGTGAGACCATTACGGAACTCGAGTTCCGTAATGGTCTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks