EMAIL THIS PAGE TO A FRIEND

TNNC2

troponin C type 2 (fast)

UniProtKB ID: P02585
Gene ID:
Human(7125) Summary: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. [provided by RefSeq, Jul 2008]
Mouse(21925) troponin C2, fast
Rat(296369) troponin C type 2 (fast)
Zebrafish(58082) troponin C type 2 (fast)
domestic cat(101086796) troponin C type 2 (fast)
dog(485899) troponin C type 2 (fast)
chicken(396434) troponin C type 2 (fast)
naked mole-rat(101724013) troponin C type 2 (fast)
Domestic Rabbit(100009341) troponin C type 2 (fast)
domestic guinea pig(100727660) troponin C type 2 (fast)
cow(615428) troponin C type 2 (fast)
sheep(101112589) troponin C type 2 (fast)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003279 Rosetta Predictions human pricing
NM_001037351 Rosetta Predictions rat pricing
NM_009394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170463 predicted 344
2 SASI_Hs01_00170464 predicted 452
3 SASI_Hs02_00335341 predicted 452
4 SASI_Hs01_00170465 predicted 352
5 SASI_Hs02_00335342 predicted 269
6 SASI_Hs02_00335343 predicted 392
7 SASI_Hs02_00335344 predicted 296
8 SASI_Hs01_00170467 predicted 361
9 SASI_Hs01_00170471 predicted 347
10 SASI_Hs01_00170472 predicted 272
11 SASI_Hs01_00170466 predicted 455
12 SASI_Hs01_00170468 predicted 453
13 SASI_Hs01_00170469 predicted 461
14 SASI_Hs01_00170470 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051358 predicted 200
2 SASI_Rn01_00051359 predicted 195
3 SASI_Rn01_00051360 predicted 193
4 SASI_Rn01_00051361 predicted 199
5 SASI_Rn01_00051362 predicted 251
6 SASI_Rn01_00051363 predicted 221
7 SASI_Rn01_00051364 predicted 214
8 SASI_Rn02_00204394 predicted 199
9 SASI_Rn01_00051366 predicted 222
10 SASI_Rn02_00204395 predicted 234
11 SASI_Rn01_00051365 predicted 248
12 SASI_Rn01_00051367 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074470 predicted 222
2 SASI_Mm01_00074471 predicted 353
3 SASI_Mm01_00074472 predicted 358
4 SASI_Mm02_00316014 predicted 403
5 SASI_Mm02_00316015 predicted 270
6 SASI_Mm01_00074474 predicted 281
7 SASI_Mm01_00074475 predicted 276
8 SASI_Mm01_00074476 predicted 332
9 SASI_Mm01_00074477 predicted 293
10 SASI_Mm02_00316016 predicted 299
11 SASI_Mm01_00074473 predicted 467
12 SASI_Mm01_00074478 predicted 388
13 SASI_Mm01_00074479 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009394
TNNC2 MISSION shRNA Bacterial Glycerol Stock
troponin C type 2 (fast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-220s1c1
Sequence:CCGGCCCACCAAAGAGGAATTGGATCTCGAGATCCAATTCCTCTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-469s1c1
Sequence:CCGGTCCCTGATGAAGGATGGTGATCTCGAGATCACCATCCTTCATCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-315s1c1
Sequence:CCGGCCAGATGAAAGAGGATGCGAACTCGAGTTCGCATCCTCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-273s1c1
Sequence:CCGGCGGTACTATCGACTTTGAAGACTCGAGTCTTCAAAGTCGATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-133s1c1
Sequence:CCGGGCTGCCTTTGACATGTTCGATCTCGAGATCGAACATGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009394
TNNC2 MISSION shRNA shRNA Plasmid DNA
troponin C type 2 (fast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-220s1c1
Sequence:CCGGCCCACCAAAGAGGAATTGGATCTCGAGATCCAATTCCTCTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-469s1c1
Sequence:CCGGTCCCTGATGAAGGATGGTGATCTCGAGATCACCATCCTTCATCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-315s1c1
Sequence:CCGGCCAGATGAAAGAGGATGCGAACTCGAGTTCGCATCCTCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-273s1c1
Sequence:CCGGCGGTACTATCGACTTTGAAGACTCGAGTCTTCAAAGTCGATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-133s1c1
Sequence:CCGGGCTGCCTTTGACATGTTCGATCTCGAGATCGAACATGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009394
TNNC2 MISSION shRNA Lentiviral Transduction Particles
troponin C type 2 (fast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-220s1c1
Sequence:CCGGCCCACCAAAGAGGAATTGGATCTCGAGATCCAATTCCTCTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-469s1c1
Sequence:CCGGTCCCTGATGAAGGATGGTGATCTCGAGATCACCATCCTTCATCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-315s1c1
Sequence:CCGGCCAGATGAAAGAGGATGCGAACTCGAGTTCGCATCCTCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-273s1c1
Sequence:CCGGCGGTACTATCGACTTTGAAGACTCGAGTCTTCAAAGTCGATAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009394.2-133s1c1
Sequence:CCGGGCTGCCTTTGACATGTTCGATCTCGAGATCGAACATGTCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003279
TNNC2 MISSION shRNA Bacterial Glycerol Stock
troponin C type 2 (fast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-313s1c1
Sequence:CCGGCAGATGAAAGAGGACGCGAAACTCGAGTTTCGCGTCCTCTTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-513s1c1
Sequence:CCGGCGACGAGTTCCTGAAGATGATCTCGAGATCATCTTCAGGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-133s1c1
Sequence:CCGGGCCTTTGACATGTTTGATGCTCTCGAGAGCATCAAACATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-282s1c1
Sequence:CCGGCTTCGAGGAGTTCTTGGTCATCTCGAGATGACCAAGAACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-468s1c1
Sequence:CCGGTCTGATGAAAGACGGCGACAACTCGAGTTGTCGCCGTCTTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-93s21c1
Sequence:CCGGGTCCTACCTCAGCGAAGAGATCTCGAGATCTCTTCGCTGAGGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-379s21c1
Sequence:CCGGAGGAATGCAGACGGCTACATCCTCGAGGATGTAGCCGTCTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-457s21c1
Sequence:CCGGGAGATCGAATCTCTGATGAAACTCGAGTTTCATCAGAGATTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-108s21c1
Sequence:CCGGAGAGATGATCGCTGAGTTCAACTCGAGTTGAACTCAGCGATCATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003279
TNNC2 MISSION shRNA shRNA Plasmid DNA
troponin C type 2 (fast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-313s1c1
Sequence:CCGGCAGATGAAAGAGGACGCGAAACTCGAGTTTCGCGTCCTCTTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-513s1c1
Sequence:CCGGCGACGAGTTCCTGAAGATGATCTCGAGATCATCTTCAGGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-133s1c1
Sequence:CCGGGCCTTTGACATGTTTGATGCTCTCGAGAGCATCAAACATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-282s1c1
Sequence:CCGGCTTCGAGGAGTTCTTGGTCATCTCGAGATGACCAAGAACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-468s1c1
Sequence:CCGGTCTGATGAAAGACGGCGACAACTCGAGTTGTCGCCGTCTTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-93s21c1
Sequence:CCGGGTCCTACCTCAGCGAAGAGATCTCGAGATCTCTTCGCTGAGGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-379s21c1
Sequence:CCGGAGGAATGCAGACGGCTACATCCTCGAGGATGTAGCCGTCTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-457s21c1
Sequence:CCGGGAGATCGAATCTCTGATGAAACTCGAGTTTCATCAGAGATTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-108s21c1
Sequence:CCGGAGAGATGATCGCTGAGTTCAACTCGAGTTGAACTCAGCGATCATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003279
TNNC2 MISSION shRNA Lentiviral Transduction Particles
troponin C type 2 (fast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-313s1c1
Sequence:CCGGCAGATGAAAGAGGACGCGAAACTCGAGTTTCGCGTCCTCTTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-513s1c1
Sequence:CCGGCGACGAGTTCCTGAAGATGATCTCGAGATCATCTTCAGGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-133s1c1
Sequence:CCGGGCCTTTGACATGTTTGATGCTCTCGAGAGCATCAAACATGTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-282s1c1
Sequence:CCGGCTTCGAGGAGTTCTTGGTCATCTCGAGATGACCAAGAACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003279.2-468s1c1
Sequence:CCGGTCTGATGAAAGACGGCGACAACTCGAGTTGTCGCCGTCTTTCATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-93s21c1
Sequence:CCGGGTCCTACCTCAGCGAAGAGATCTCGAGATCTCTTCGCTGAGGTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-379s21c1
Sequence:CCGGAGGAATGCAGACGGCTACATCCTCGAGGATGTAGCCGTCTGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-457s21c1
Sequence:CCGGGAGATCGAATCTCTGATGAAACTCGAGTTTCATCAGAGATTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003279.2-108s21c1
Sequence:CCGGAGAGATGATCGCTGAGTTCAACTCGAGTTGAACTCAGCGATCATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks