EMAIL THIS PAGE TO A FRIEND

TNNI1

troponin I type 1 (skeletal, slow)

Synonyms: SSTNI TNN1
Gene ID:
Human(7135) Summary: Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]
Mouse(21952) troponin I, skeletal, slow 1
Rat(29388) troponin I type 1 (skeletal, slow)
cow(100301375) troponin I type 1 (skeletal, slow)
Goat(100860774) troponin I type 1 (skeletal, slow)
domestic guinea pig(100733717) troponin I type 1 (skeletal, slow)
naked mole-rat(101720739) troponin I type 1 (skeletal, slow)
chicken(421161) troponin I type 1 (skeletal, slow)
domestic cat(101096197) troponin I type 1 (skeletal, slow)
dog(100685160) troponin I type 1 (skeletal, slow)
Gene Class: Cytoskeleton
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074271 MISSION® esiRNA esiRNA human TNNI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003281 Rosetta Predictions human pricing
NM_017184 Rosetta Predictions rat pricing
NM_001112702 Rosetta Predictions mouse pricing
NM_021467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072730 predicted 1002
2 SASI_Hs01_00072731 predicted 322
3 SASI_Hs01_00072732 predicted 340
4 SASI_Hs01_00072733 predicted 1024
5 SASI_Hs01_00072734 predicted 386
6 SASI_Hs01_00072735 predicted 801
7 SASI_Hs02_00335345 predicted 1052
8 SASI_Hs01_00072736 predicted 493
9 SASI_Hs01_00072737 predicted 1040
10 SASI_Hs01_00072738 predicted 511
11 SASI_Hs01_00072739 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042292 predicted 223
2 SASI_Rn01_00042293 predicted 286
3 SASI_Rn01_00042294 predicted 283
4 SASI_Rn01_00042295 predicted 413
5 SASI_Rn01_00042296 predicted 545
6 SASI_Rn01_00042297 predicted 277
7 SASI_Rn01_00042298 predicted 383
8 SASI_Rn01_00042299 predicted 419
9 SASI_Rn01_00042300 predicted 263
10 SASI_Rn01_00042301 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306943 predicted 590
2 SASI_Mm02_00306944 predicted 679
3 SASI_Mm02_00306945 predicted 260
4 SASI_Mm02_00306946 predicted 339
5 SASI_Mm02_00306947 predicted 318
6 SASI_Mm02_00306948 predicted 651
7 SASI_Mm02_00306949 predicted 676
8 SASI_Mm02_00306950 predicted 325
9 SASI_Mm02_00306951 predicted 234
10 SASI_Mm02_00306952 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326131 predicted 631
2 SASI_Mm01_00061746 predicted 729
3 SASI_Mm02_00326132 predicted 311
4 SASI_Mm01_00061749 predicted 393
5 SASI_Mm01_00061752 predicted 361
6 SASI_Mm01_00061753 predicted 695
7 SASI_Mm01_00061754 predicted 724
8 SASI_Mm02_00326133 predicted 374
9 SASI_Mm02_00326134 predicted 280
10 SASI_Mm02_00326135 predicted 713
11 SASI_Mm01_00061745 predicted 322
12 SASI_Mm01_00061747 predicted 215
13 SASI_Mm01_00061748 predicted 329
14 SASI_Mm01_00061750 predicted 553
15 SASI_Mm01_00061751 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003281
TNNI1 MISSION shRNA Bacterial Glycerol Stock
troponin I type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003281.3-1010s21c1
Sequence:CCGGCATCACACCTTCTTCATTAAACTCGAGTTTAATGAAGAAGGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003281.3-333s21c1
Sequence:CCGGATACGACATTGAGGCCAAATGCTCGAGCATTTGGCCTCAATGTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003281.3-2102s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-352s1c1
Sequence:CCGGGATTAAGGACCTGAAGCTGAACTCGAGTTCAGCTTCAGGTCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-508s1c1
Sequence:CCGGGAAGAAGGAAGACACAGAGAACTCGAGTTCTCTGTGTCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-499s1c1
Sequence:CCGGCAAGTCTGTGAAGAAGGAAGACTCGAGTCTTCCTTCTTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-591s1c1
Sequence:CCGGGCCGGAAGAAGATGTTTGATGCTCGAGCATCAAACATCTTCTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-616s1c1
Sequence:CCGGCAAGTCTCCGACCTCACAATACTCGAGTATTGTGAGGTCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003281
TNNI1 MISSION shRNA shRNA Plasmid DNA
troponin I type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003281.3-1010s21c1
Sequence:CCGGCATCACACCTTCTTCATTAAACTCGAGTTTAATGAAGAAGGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003281.3-333s21c1
Sequence:CCGGATACGACATTGAGGCCAAATGCTCGAGCATTTGGCCTCAATGTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003281.3-2102s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-352s1c1
Sequence:CCGGGATTAAGGACCTGAAGCTGAACTCGAGTTCAGCTTCAGGTCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-508s1c1
Sequence:CCGGGAAGAAGGAAGACACAGAGAACTCGAGTTCTCTGTGTCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-499s1c1
Sequence:CCGGCAAGTCTGTGAAGAAGGAAGACTCGAGTCTTCCTTCTTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-591s1c1
Sequence:CCGGGCCGGAAGAAGATGTTTGATGCTCGAGCATCAAACATCTTCTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-616s1c1
Sequence:CCGGCAAGTCTCCGACCTCACAATACTCGAGTATTGTGAGGTCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003281
TNNI1 MISSION shRNA Lentiviral Transduction Particles
troponin I type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003281.3-1010s21c1
Sequence:CCGGCATCACACCTTCTTCATTAAACTCGAGTTTAATGAAGAAGGTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003281.3-333s21c1
Sequence:CCGGATACGACATTGAGGCCAAATGCTCGAGCATTTGGCCTCAATGTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003281.3-2102s1c1
Sequence:CCGGCCTCCCAAAGTTCTGGGATTACTCGAGTAATCCCAGAACTTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-352s1c1
Sequence:CCGGGATTAAGGACCTGAAGCTGAACTCGAGTTCAGCTTCAGGTCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-508s1c1
Sequence:CCGGGAAGAAGGAAGACACAGAGAACTCGAGTTCTCTGTGTCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-499s1c1
Sequence:CCGGCAAGTCTGTGAAGAAGGAAGACTCGAGTCTTCCTTCTTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-591s1c1
Sequence:CCGGGCCGGAAGAAGATGTTTGATGCTCGAGCATCAAACATCTTCTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003281.2-616s1c1
Sequence:CCGGCAAGTCTCCGACCTCACAATACTCGAGTATTGTGAGGTCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021467
TNNI1 MISSION shRNA Bacterial Glycerol Stock
troponin I type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-445s1c1
Sequence:CCGGCGCTATGATATTGAAGCCAAACTCGAGTTTGGCTTCAATATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021467.4-906s1c1
Sequence:CCGGCCAGGATGAAATGGCACACAACTCGAGTTGTGTGCCATTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-456s1c1
Sequence:CCGGTGAAGCCAAATGCCTCCACAACTCGAGTTGTGGAGGCATTTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-732s1c1
Sequence:CCGGGAAGATGTTCGACGCTGCTAACTCGAGTTAGCAGCGTCGAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-243s1c1
Sequence:CCGGCTCCCGTAAACTCATGCTGAACTCGAGTTCAGCATGAGTTTACGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021467
TNNI1 MISSION shRNA shRNA Plasmid DNA
troponin I type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-445s1c1
Sequence:CCGGCGCTATGATATTGAAGCCAAACTCGAGTTTGGCTTCAATATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021467.4-906s1c1
Sequence:CCGGCCAGGATGAAATGGCACACAACTCGAGTTGTGTGCCATTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-456s1c1
Sequence:CCGGTGAAGCCAAATGCCTCCACAACTCGAGTTGTGGAGGCATTTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-732s1c1
Sequence:CCGGGAAGATGTTCGACGCTGCTAACTCGAGTTAGCAGCGTCGAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-243s1c1
Sequence:CCGGCTCCCGTAAACTCATGCTGAACTCGAGTTCAGCATGAGTTTACGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021467
TNNI1 MISSION shRNA Lentiviral Transduction Particles
troponin I type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-445s1c1
Sequence:CCGGCGCTATGATATTGAAGCCAAACTCGAGTTTGGCTTCAATATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021467.4-906s1c1
Sequence:CCGGCCAGGATGAAATGGCACACAACTCGAGTTGTGTGCCATTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-456s1c1
Sequence:CCGGTGAAGCCAAATGCCTCCACAACTCGAGTTGTGGAGGCATTTGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-732s1c1
Sequence:CCGGGAAGATGTTCGACGCTGCTAACTCGAGTTAGCAGCGTCGAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021467.4-243s1c1
Sequence:CCGGCTCCCGTAAACTCATGCTGAACTCGAGTTCAGCATGAGTTTACGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks