EMAIL THIS PAGE TO A FRIEND

TNNI2

troponin I type 2 (skeletal, fast)

Synonyms: AMCD2B DA2B FSSV fsTnI
UniProtKB ID: P48788, A6NIV8, A6NJU5
Gene ID:
Human(7136) Summary: This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(21953) troponin I, skeletal, fast 2
Rat(29389) troponin I type 2 (skeletal, fast)
chicken(396386) troponin I type 2 (skeletal, fast)
dog(475995) troponin I type 2 (skeletal, fast)
naked mole-rat(101717320) troponin I type 2 (skeletal, fast)
Domestic Rabbit(100009581) troponin I type 2 (skeletal, fast)
domestic guinea pig(100722531) troponin I type 2 (skeletal, fast)
cow(506434) troponin I type 2 (skeletal, fast)
sheep(101121135) troponin I type 2 (skeletal, fast)
cow(790768) troponin I, fast skeletal muscle-like
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003282 Rosetta Predictions human pricing
NM_017185 Rosetta Predictions rat pricing
NM_009405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235646 predicted 243
2 SASI_Hs01_00235647 predicted 367
3 SASI_Hs01_00235648 predicted 226
4 SASI_Hs01_00235649 predicted 369
5 SASI_Hs01_00235650 predicted 415
6 SASI_Hs01_00235651 predicted 365
7 SASI_Hs01_00235652 predicted 246
8 SASI_Hs01_00235653 predicted 659
9 SASI_Hs01_00235654 predicted 80
10 SASI_Hs01_00235655 predicted 177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079937 predicted 292
2 SASI_Rn01_00079938 predicted 217
3 SASI_Rn01_00079940 predicted 222
4 SASI_Rn01_00079941 predicted 322
5 SASI_Rn01_00079942 predicted 250
6 SASI_Rn01_00079943 predicted 426
7 SASI_Rn01_00079944 predicted 438
8 SASI_Rn01_00079945 predicted 410
9 SASI_Rn01_00079946 predicted 246
10 SASI_Rn02_00261521 predicted 275
11 SASI_Rn01_00079939 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316041 predicted 235
2 SASI_Mm01_00077436 predicted 352
3 SASI_Mm01_00077435 predicted 215
4 SASI_Mm01_00077437 predicted 312
5 SASI_Mm02_00316042 predicted 217
6 SASI_Mm01_00077440 predicted 265
7 SASI_Mm02_00316043 predicted 230
8 SASI_Mm01_00077441 predicted 415
9 SASI_Mm01_00077442 predicted 429
10 SASI_Mm02_00316044 predicted 368
11 SASI_Mm01_00077433 predicted 290
12 SASI_Mm01_00077434 predicted 305
13 SASI_Mm01_00077438 predicted 233
14 SASI_Mm01_00077439 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003282
TNNI2 MISSION shRNA Bacterial Glycerol Stock
troponin I type 2 (skeletal, fast)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-306s1c1
Sequence:CCGGGAGGACATGAACCAGAAGCTACTCGAGTAGCTTCTGGTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-548s1c1
Sequence:CCGGGAAGAAGATGTTTGAGTCCGACTCGAGTCGGACTCAAACATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-137s1c1
Sequence:CCGGTGAGGCAGAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-234s1c1
Sequence:CCGGGCCAAGATCGATGCGGCTGAACTCGAGTTCAGCCGCATCGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-251s1c1
Sequence:CCGGTGAAGAGGAGAAGTACGACATCTCGAGATGTCGTACTTCTCCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003282.3-542s21c1
Sequence:CCGGGAACATCGAGGAGAAGTCTGGCTCGAGCCAGACTTCTCCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003282
TNNI2 MISSION shRNA shRNA Plasmid DNA
troponin I type 2 (skeletal, fast)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-306s1c1
Sequence:CCGGGAGGACATGAACCAGAAGCTACTCGAGTAGCTTCTGGTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-548s1c1
Sequence:CCGGGAAGAAGATGTTTGAGTCCGACTCGAGTCGGACTCAAACATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-137s1c1
Sequence:CCGGTGAGGCAGAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-234s1c1
Sequence:CCGGGCCAAGATCGATGCGGCTGAACTCGAGTTCAGCCGCATCGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-251s1c1
Sequence:CCGGTGAAGAGGAGAAGTACGACATCTCGAGATGTCGTACTTCTCCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003282.3-542s21c1
Sequence:CCGGGAACATCGAGGAGAAGTCTGGCTCGAGCCAGACTTCTCCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003282
TNNI2 MISSION shRNA Lentiviral Transduction Particles
troponin I type 2 (skeletal, fast)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-306s1c1
Sequence:CCGGGAGGACATGAACCAGAAGCTACTCGAGTAGCTTCTGGTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-548s1c1
Sequence:CCGGGAAGAAGATGTTTGAGTCCGACTCGAGTCGGACTCAAACATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-137s1c1
Sequence:CCGGTGAGGCAGAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-234s1c1
Sequence:CCGGGCCAAGATCGATGCGGCTGAACTCGAGTTCAGCCGCATCGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003282.1-251s1c1
Sequence:CCGGTGAAGAGGAGAAGTACGACATCTCGAGATGTCGTACTTCTCCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003282.3-542s21c1
Sequence:CCGGGAACATCGAGGAGAAGTCTGGCTCGAGCCAGACTTCTCCTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009405
TNNI2 MISSION shRNA Bacterial Glycerol Stock
troponin I type 2 (skeletal, fast)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-210s1c1
Sequence:CCGGGAACTCTGCAAACAACTGCATCTCGAGATGCAGTTGTTTGCAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-231s1c1
Sequence:CCGGGCGAAGATCGACGTTGCTGAACTCGAGTTCAGCAACGTCGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-243s1c1
Sequence:CCGGGTTGCTGAAGAGGAGAAATATCTCGAGATATTTCTCCTCTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-368s1c1
Sequence:CCGGGCGTATGTCTGCCGACGCCATCTCGAGATGGCGTCGGCAGACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009405
TNNI2 MISSION shRNA shRNA Plasmid DNA
troponin I type 2 (skeletal, fast)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-210s1c1
Sequence:CCGGGAACTCTGCAAACAACTGCATCTCGAGATGCAGTTGTTTGCAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-231s1c1
Sequence:CCGGGCGAAGATCGACGTTGCTGAACTCGAGTTCAGCAACGTCGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-243s1c1
Sequence:CCGGGTTGCTGAAGAGGAGAAATATCTCGAGATATTTCTCCTCTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-368s1c1
Sequence:CCGGGCGTATGTCTGCCGACGCCATCTCGAGATGGCGTCGGCAGACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009405
TNNI2 MISSION shRNA Lentiviral Transduction Particles
troponin I type 2 (skeletal, fast)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-210s1c1
Sequence:CCGGGAACTCTGCAAACAACTGCATCTCGAGATGCAGTTGTTTGCAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-231s1c1
Sequence:CCGGGCGAAGATCGACGTTGCTGAACTCGAGTTCAGCAACGTCGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-243s1c1
Sequence:CCGGGTTGCTGAAGAGGAGAAATATCTCGAGATATTTCTCCTCTTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009405.1-368s1c1
Sequence:CCGGGCGTATGTCTGCCGACGCCATCTCGAGATGGCGTCGGCAGACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks