EMAIL THIS PAGE TO A FRIEND

TNNI3

troponin I type 3 (cardiac)

Synonyms: CMD1FF CMD2A CMH7 RCM1 TNNC1 cTnI
UniProtKB ID: P19429
Gene ID:
Human(7137) Summary: Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). [provided by RefSeq, Jul 2008]
Mouse(21954) troponin I, cardiac 3
Rat(29248) troponin I type 3 (cardiac)
chicken(396428) troponin I type 3 (cardiac)
domestic cat(493744) troponin I type 3 (cardiac)
Horse(100034065) troponin I type 3 (cardiac)
dog(403566) troponin I type 3 (cardiac)
sheep(101121961) troponin I type 3 (cardiac)
domestic guinea pig(100718375) troponin I type 3 (cardiac)
naked mole-rat(101711288) troponin I type 3 (cardiac)
Gene Class: Cytoskeleton
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504001 Anti-phospho-TNNI3 (pSer22+Ser23) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504109 Anti-phospho-TNNI3 (pSer43) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301536 Anti-phospho-TNNI3 (pSer43) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504002 Anti-phospho-TNNI3 (pThr142) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301524 Anti-phospho-TNNI3 (pThr142) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB2108732 Anti-TNNI3 affinity isolated antibody horse, rat, guinea pig, rabbit, zebrafish, mouse, pig, horse, goat, canine, bovine
immunohistochemistry, western blot pricing
SAB2502169 Anti-TNNI3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, bovine
ELISA, western blot pricing
SAB2502170 Anti-TNNI3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, bovine, mouse, rat, pig
ELISA, western blot pricing
SAB2102499 Anti-TNNI3 antibody produced in rabbit affinity isolated antibody rat, rabbit, canine, pig, bovine, rabbit, guinea pig, human, horse, mouse
western blot pricing
HPA046428 Anti-TNNI3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502991 Anti-TNNI3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB1411356 Anti-TNNI3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4502990 Anti-Tnni3, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
SAB4502992 Anti-TNNI3, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB1305511 MONOCLONAL ANTI-TNINI3 antibody produced in mouse clone 358CT10.3.6, crude ascites, buffered aqueous solution human
western blot pricing
WH0007137M4 Monoclonal Anti-TNNI3 antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300191 Monoclonal Anti-TNNI3 antibody produced in mouse clone 3A10A12, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0634 Human TNNI3 / Troponin I, Cardiac Muscle ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000363 Rosetta Predictions human pricing
NM_017144 Rosetta Predictions rat pricing
NM_009406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245041 predicted 539
2 SASI_Hs02_00302413 predicted 520
3 SASI_Hs01_00245042 predicted 511
4 SASI_Hs01_00245043 predicted 525
5 SASI_Hs01_00245044 predicted 470
6 SASI_Hs01_00245045 predicted 467
7 SASI_Hs01_00245046 predicted 285
8 SASI_Hs01_00245047 predicted 533
9 SASI_Hs01_00245048 predicted 513
10 SASI_Hs02_00302414 predicted 572
11 SASI_Hs01_00245049 predicted 523
12 SASI_Hs01_00245050 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062998 predicted 386
2 SASI_Rn01_00063000 predicted 309
3 SASI_Rn01_00063001 predicted 469
4 SASI_Rn01_00063002 predicted 355
5 SASI_Rn01_00063003 predicted 255
6 SASI_Rn02_00261402 predicted 479
7 SASI_Rn01_00063004 predicted 264
8 SASI_Rn02_00261403 predicted 532
9 SASI_Rn01_00063005 predicted 341
10 SASI_Rn02_00261404 predicted 253
11 SASI_Rn01_00062996 predicted 426
12 SASI_Rn01_00062997 predicted 445
13 SASI_Rn01_00062999 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038092 predicted 569
2 SASI_Mm01_00038094 predicted 568
3 SASI_Mm01_00038095 predicted 451
4 SASI_Mm01_00038096 predicted 393
5 SASI_Mm01_00038097 predicted 374
6 SASI_Mm01_00038098 predicted 419
7 SASI_Mm01_00038099 predicted 491
8 SASI_Mm01_00038100 predicted 303
9 SASI_Mm01_00038101 predicted 496
10 SASI_Mm02_00316045 predicted 290
11 SASI_Mm01_00038093 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000363
VALIDATED
TNNI3 MISSION shRNA Bacterial Glycerol Stock
troponin I type 3 (cardiac)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-712s21c1
Sequence:CCGGACTGGCGCAAGAACATCGATGCTCGAGCATCGATGTTCTTGCGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-726s21c1
Sequence:CCGGATCGATGCACTGAGTGGAATGCTCGAGCATTCCACTCAGTGCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-301s21c1
Sequence:CCGGTGCTGCAGATTGCAAAGCAAGCTCGAGCTTGCTTTGCAATCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-509s21c1
Sequence:CCGGCACGGAGATTGCAGATCTGACCTCGAGGTCAGATCTGCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-419s1c1
Sequence:CCGGGAGATACGACATAGAGGCAAACTCGAGTTTGCCTCTATGTCGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-485s1c1
Sequence:CCGGCTTTGACCTTCGAGGCAAGTTCTCGAGAACTTGCCTCGAAGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-474s1c1
Sequence:CCGGACTCAGAAGATCTTTGACCTTCTCGAGAAGGTCAAAGATCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-525s1c1
Sequence:CCGGAGAGTGAGGATCTCTGCAGATCTCGAGATCTGCAGAGATCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-411s1c1
Sequence:CCGGGATGAAGAGAGATACGACATACTCGAGTATGTCGTATCTCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000363
VALIDATED
TNNI3 MISSION shRNA shRNA Plasmid DNA
troponin I type 3 (cardiac)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-712s21c1
Sequence:CCGGACTGGCGCAAGAACATCGATGCTCGAGCATCGATGTTCTTGCGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-726s21c1
Sequence:CCGGATCGATGCACTGAGTGGAATGCTCGAGCATTCCACTCAGTGCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-301s21c1
Sequence:CCGGTGCTGCAGATTGCAAAGCAAGCTCGAGCTTGCTTTGCAATCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-509s21c1
Sequence:CCGGCACGGAGATTGCAGATCTGACCTCGAGGTCAGATCTGCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-419s1c1
Sequence:CCGGGAGATACGACATAGAGGCAAACTCGAGTTTGCCTCTATGTCGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-485s1c1
Sequence:CCGGCTTTGACCTTCGAGGCAAGTTCTCGAGAACTTGCCTCGAAGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-474s1c1
Sequence:CCGGACTCAGAAGATCTTTGACCTTCTCGAGAAGGTCAAAGATCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-525s1c1
Sequence:CCGGAGAGTGAGGATCTCTGCAGATCTCGAGATCTGCAGAGATCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-411s1c1
Sequence:CCGGGATGAAGAGAGATACGACATACTCGAGTATGTCGTATCTCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000363
VALIDATED
TNNI3 MISSION shRNA Lentiviral Transduction Particles
troponin I type 3 (cardiac)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-712s21c1
Sequence:CCGGACTGGCGCAAGAACATCGATGCTCGAGCATCGATGTTCTTGCGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-726s21c1
Sequence:CCGGATCGATGCACTGAGTGGAATGCTCGAGCATTCCACTCAGTGCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-301s21c1
Sequence:CCGGTGCTGCAGATTGCAAAGCAAGCTCGAGCTTGCTTTGCAATCTGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000363.4-509s21c1
Sequence:CCGGCACGGAGATTGCAGATCTGACCTCGAGGTCAGATCTGCAATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-419s1c1
Sequence:CCGGGAGATACGACATAGAGGCAAACTCGAGTTTGCCTCTATGTCGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-485s1c1
Sequence:CCGGCTTTGACCTTCGAGGCAAGTTCTCGAGAACTTGCCTCGAAGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-474s1c1
Sequence:CCGGACTCAGAAGATCTTTGACCTTCTCGAGAAGGTCAAAGATCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-525s1c1
Sequence:CCGGAGAGTGAGGATCTCTGCAGATCTCGAGATCTGCAGAGATCCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000363.3-411s1c1
Sequence:CCGGGATGAAGAGAGATACGACATACTCGAGTATGTCGTATCTCTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009406
TNNI3 MISSION shRNA Bacterial Glycerol Stock
troponin I type 3 (cardiac)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-578s21c1
Sequence:CCGGCTCTGCAGATGCCATGATGCACTCGAGTGCATCATGGCATCTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-312s21c1
Sequence:CCGGATGGAACGAGAGGCAGAAGAGCTCGAGCTCTTCTGCCTCTCGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-412s21c1
Sequence:CCGGAGGACTTATGCCGACAGCTTCCTCGAGGAAGCTGTCGGCATAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-280s21c1
Sequence:CCGGAGACTCTGATGCTGCAGATTGCTCGAGCAATCTGCAGCATCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-456s1c1
Sequence:CCGGGAAGAGAGATATGACGTGGAACTCGAGTTCCACGTCATATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-699s1c1
Sequence:CCGGGACTGGCGCAAGAATATCGATCTCGAGATCGATATTCTTGCGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-644s1c1
Sequence:CCGGCCACCTCAAGCAGGTGAAGAACTCGAGTTCTTCACCTGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-198s1c1
Sequence:CCGGTCTGCCAACTACCGAGCCTATCTCGAGATAGGCTCGGTAGTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009406
TNNI3 MISSION shRNA shRNA Plasmid DNA
troponin I type 3 (cardiac)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-578s21c1
Sequence:CCGGCTCTGCAGATGCCATGATGCACTCGAGTGCATCATGGCATCTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-312s21c1
Sequence:CCGGATGGAACGAGAGGCAGAAGAGCTCGAGCTCTTCTGCCTCTCGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-412s21c1
Sequence:CCGGAGGACTTATGCCGACAGCTTCCTCGAGGAAGCTGTCGGCATAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-280s21c1
Sequence:CCGGAGACTCTGATGCTGCAGATTGCTCGAGCAATCTGCAGCATCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-456s1c1
Sequence:CCGGGAAGAGAGATATGACGTGGAACTCGAGTTCCACGTCATATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-699s1c1
Sequence:CCGGGACTGGCGCAAGAATATCGATCTCGAGATCGATATTCTTGCGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-644s1c1
Sequence:CCGGCCACCTCAAGCAGGTGAAGAACTCGAGTTCTTCACCTGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-198s1c1
Sequence:CCGGTCTGCCAACTACCGAGCCTATCTCGAGATAGGCTCGGTAGTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009406
TNNI3 MISSION shRNA Lentiviral Transduction Particles
troponin I type 3 (cardiac)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-578s21c1
Sequence:CCGGCTCTGCAGATGCCATGATGCACTCGAGTGCATCATGGCATCTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-312s21c1
Sequence:CCGGATGGAACGAGAGGCAGAAGAGCTCGAGCTCTTCTGCCTCTCGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-412s21c1
Sequence:CCGGAGGACTTATGCCGACAGCTTCCTCGAGGAAGCTGTCGGCATAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009406.3-280s21c1
Sequence:CCGGAGACTCTGATGCTGCAGATTGCTCGAGCAATCTGCAGCATCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-456s1c1
Sequence:CCGGGAAGAGAGATATGACGTGGAACTCGAGTTCCACGTCATATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-699s1c1
Sequence:CCGGGACTGGCGCAAGAATATCGATCTCGAGATCGATATTCTTGCGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-644s1c1
Sequence:CCGGCCACCTCAAGCAGGTGAAGAACTCGAGTTCTTCACCTGCTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009406.2-198s1c1
Sequence:CCGGTCTGCCAACTACCGAGCCTATCTCGAGATAGGCTCGGTAGTTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks