EMAIL THIS PAGE TO A FRIEND

TNNI3K

TNNI3 interacting kinase

Synonyms: CARK
UniProtKB ID: Q59H18, Q17RN0, Q49AR1, Q6MZS9, Q9Y2V6
Gene ID:
Human(51086) Summary: This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
Mouse(435766) TNNI3 interacting kinase
Rat(295531) TNNI3 interacting kinase
naked mole-rat(101714008) TNNI3 interacting kinase
Domestic Rabbit(100533992) TNNI3 interacting kinase
domestic guinea pig(101788215) TNNI3 interacting kinase
cow(535940) TNNI3 interacting kinase
Zebrafish(799621) TNNI3 interacting kinase
dog(100533996) TNNI3 interacting kinase
Horse(100533994) TNNI3 interacting kinase
domestic cat(101085560) TNNI3 interacting kinase
chicken(100533999) TNNI3 interacting kinase
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_487772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_487772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_487772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025181 MISSION® esiRNA esiRNA human TNNI3K (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112808 Rosetta Predictions human pricing
NM_015978 Rosetta Predictions human pricing
NM_181769 Rosetta Predictions rat pricing
NM_001012364 Rosetta Predictions mouse pricing
NM_177066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325565 predicted 1030
2 SASI_Hs02_00325566 predicted 2285
3 SASI_Hs02_00325567 predicted 1463
4 SASI_Hs02_00325568 predicted 1264
5 SASI_Hs02_00325569 predicted 2581
6 SASI_Hs02_00325570 predicted 1862
7 SASI_Hs02_00325571 predicted 1789
8 SASI_Hs02_00325572 predicted 819
9 SASI_Hs02_00325573 predicted 1791
10 SASI_Hs02_00325574 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348648 predicted 764
2 SASI_Hs01_00218539 predicted 2016
3 SASI_Hs02_00348649 predicted 1807
4 SASI_Hs01_00218540 predicted 1195
5 SASI_Hs01_00218541 predicted 1001
6 SASI_Hs01_00218542 predicted 2317
7 SASI_Hs01_00218543 predicted 1589
8 SASI_Hs01_00218545 predicted 1515
9 SASI_Hs01_00218546 predicted 557
10 SASI_Hs01_00218547 predicted 1971
11 SASI_Hs01_00218544 predicted 1556
12 SASI_Hs01_00218548 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063007 predicted 288
2 SASI_Rn01_00063008 predicted 2400
3 SASI_Rn01_00063009 predicted 1002
4 SASI_Rn01_00063010 predicted 2168
5 SASI_Rn01_00063011 predicted 2383
6 SASI_Rn02_00269801 predicted 1962
7 SASI_Rn01_00063013 predicted 560
8 SASI_Rn01_00063014 predicted 2467
9 SASI_Rn02_00269802 predicted 510
10 SASI_Rn01_00063015 predicted 840
11 SASI_Rn01_00063006 predicted 2222
12 SASI_Rn01_00063012 predicted 2466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184836 predicted 858
2 SASI_Mm01_00184837 predicted 351
3 SASI_Mm01_00184838 predicted 912
4 SASI_Mm01_00184839 predicted 1285
5 SASI_Mm01_00184840 predicted 1253
6 SASI_Mm01_00184841 predicted 643
7 SASI_Mm01_00184842 predicted 1194
8 SASI_Mm01_00184843 predicted 763
9 SASI_Mm01_00184844 predicted 1699
10 SASI_Mm01_00184845 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139693 predicted 848
2 SASI_Mm02_00347025 predicted 2277
3 SASI_Mm02_00347026 predicted 2410
4 SASI_Mm01_00139695 predicted 906
5 SASI_Mm02_00347027 predicted 2457
6 SASI_Mm01_00139697 predicted 1244
7 SASI_Mm01_00139698 predicted 636
8 SASI_Mm02_00347028 predicted 2202
9 SASI_Mm01_00139699 predicted 1190
10 SASI_Mm01_00139701 predicted 1687
11 SASI_Mm01_00139694 predicted 347
12 SASI_Mm01_00139696 predicted 1292
13 SASI_Mm01_00139700 predicted 768
14 SASI_Mm01_00139702 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177066
TNNI3K MISSION shRNA Bacterial Glycerol Stock
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-141s1c1
Sequence:CCGGGAAGATGACCTGCAGATCAAACTCGAGTTTGATCTGCAGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-502s1c1
Sequence:CCGGCTTCCCTCAAGTCAGAAGAAACTCGAGTTTCTTCTGACTTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-327s1c1
Sequence:CCGGCCATCCAGACTGACAAGAAATCTCGAGATTTCTTGTCAGTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-278s1c1
Sequence:CCGGCGGTGGCAACAAGTCGCATATCTCGAGATATGCGACTTGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-186s1c1
Sequence:CCGGCACATCTTTGGCTCTGACGAACTCGAGTTCGTCAGAGCCAAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177066
TNNI3K MISSION shRNA shRNA Plasmid DNA
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-141s1c1
Sequence:CCGGGAAGATGACCTGCAGATCAAACTCGAGTTTGATCTGCAGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-502s1c1
Sequence:CCGGCTTCCCTCAAGTCAGAAGAAACTCGAGTTTCTTCTGACTTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-327s1c1
Sequence:CCGGCCATCCAGACTGACAAGAAATCTCGAGATTTCTTGTCAGTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-278s1c1
Sequence:CCGGCGGTGGCAACAAGTCGCATATCTCGAGATATGCGACTTGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-186s1c1
Sequence:CCGGCACATCTTTGGCTCTGACGAACTCGAGTTCGTCAGAGCCAAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177066
TNNI3K MISSION shRNA Lentiviral Transduction Particles
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-141s1c1
Sequence:CCGGGAAGATGACCTGCAGATCAAACTCGAGTTTGATCTGCAGGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-502s1c1
Sequence:CCGGCTTCCCTCAAGTCAGAAGAAACTCGAGTTTCTTCTGACTTGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-327s1c1
Sequence:CCGGCCATCCAGACTGACAAGAAATCTCGAGATTTCTTGTCAGTCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-278s1c1
Sequence:CCGGCGGTGGCAACAAGTCGCATATCTCGAGATATGCGACTTGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177066.2-186s1c1
Sequence:CCGGCACATCTTTGGCTCTGACGAACTCGAGTTCGTCAGAGCCAAAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015978
TNNI3K MISSION shRNA Bacterial Glycerol Stock
TNNI3 interacting kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-571s1c1
Sequence:CCGGGCAGCGTACTATGGACATGAACTCGAGTTCATGTCCATAGTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-361s1c1
Sequence:CCGGGCCTTGCATTTAGCAGTTTACCTCGAGGTAAACTGCTAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1117s1c1
Sequence:CCGGGTTCAGTTCTTACTGGATAATCTCGAGATTATCCAGTAAGAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1027s1c1
Sequence:CCGGCTTGATCAGAATGTCATAAACCTCGAGGTTTATGACATTCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1658s1c1
Sequence:CCGGCCATTGTCACTCAATACATATCTCGAGATATGTATTGAGTGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2352s1c1
Sequence:CCGGCGAATTGGAATATGCTCTAAACTCGAGTTTAGAGCATATTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-211s1c1
Sequence:CCGGGCCTTCAGTAAAGTCAATTTACTCGAGTAAATTGACTTTACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-2167s1c1
Sequence:CCGGCCTGAAGGAAGACCCGAATTTCTCGAGAAATTCGGGTCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2129s1c1
Sequence:CCGGCCATATCATCTCTGCTGATACCTCGAGGTATCAGCAGAGATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.1-2725s1c1
Sequence:CCGGGATTTGTGCCTAAGGAATAATCTCGAGATTATTCCTTAGGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-765s1c1
Sequence:CCGGACTCCATTTCTGTTCTCGATTCTCGAGAATCGAGAACAGAAATGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.x-2874s1c1
Sequence:CCGGTGGGCTGAATTATGTAGACTTCTCGAGAAGTCTACATAATTCAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-2117s1c1
Sequence:CCGGCCATTCCCAAGCCCATATCATCTCGAGATGATATGGGCTTGGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1797s1c1
Sequence:CCGGGCCAATTATACATCGTGACTTCTCGAGAAGTCACGATGTATAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1596s1c1
Sequence:CCGGGCTCAATCATCCCTGCGTAATCTCGAGATTACGCAGGGATGATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015978
TNNI3K MISSION shRNA shRNA Plasmid DNA
TNNI3 interacting kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-571s1c1
Sequence:CCGGGCAGCGTACTATGGACATGAACTCGAGTTCATGTCCATAGTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-361s1c1
Sequence:CCGGGCCTTGCATTTAGCAGTTTACCTCGAGGTAAACTGCTAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1117s1c1
Sequence:CCGGGTTCAGTTCTTACTGGATAATCTCGAGATTATCCAGTAAGAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1027s1c1
Sequence:CCGGCTTGATCAGAATGTCATAAACCTCGAGGTTTATGACATTCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1658s1c1
Sequence:CCGGCCATTGTCACTCAATACATATCTCGAGATATGTATTGAGTGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2352s1c1
Sequence:CCGGCGAATTGGAATATGCTCTAAACTCGAGTTTAGAGCATATTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-211s1c1
Sequence:CCGGGCCTTCAGTAAAGTCAATTTACTCGAGTAAATTGACTTTACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-2167s1c1
Sequence:CCGGCCTGAAGGAAGACCCGAATTTCTCGAGAAATTCGGGTCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2129s1c1
Sequence:CCGGCCATATCATCTCTGCTGATACCTCGAGGTATCAGCAGAGATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.1-2725s1c1
Sequence:CCGGGATTTGTGCCTAAGGAATAATCTCGAGATTATTCCTTAGGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-765s1c1
Sequence:CCGGACTCCATTTCTGTTCTCGATTCTCGAGAATCGAGAACAGAAATGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.x-2874s1c1
Sequence:CCGGTGGGCTGAATTATGTAGACTTCTCGAGAAGTCTACATAATTCAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-2117s1c1
Sequence:CCGGCCATTCCCAAGCCCATATCATCTCGAGATGATATGGGCTTGGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1797s1c1
Sequence:CCGGGCCAATTATACATCGTGACTTCTCGAGAAGTCACGATGTATAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1596s1c1
Sequence:CCGGGCTCAATCATCCCTGCGTAATCTCGAGATTACGCAGGGATGATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015978
TNNI3K MISSION shRNA Lentiviral Transduction Particles
TNNI3 interacting kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-571s1c1
Sequence:CCGGGCAGCGTACTATGGACATGAACTCGAGTTCATGTCCATAGTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-361s1c1
Sequence:CCGGGCCTTGCATTTAGCAGTTTACCTCGAGGTAAACTGCTAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1117s1c1
Sequence:CCGGGTTCAGTTCTTACTGGATAATCTCGAGATTATCCAGTAAGAACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1027s1c1
Sequence:CCGGCTTGATCAGAATGTCATAAACCTCGAGGTTTATGACATTCTGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-1658s1c1
Sequence:CCGGCCATTGTCACTCAATACATATCTCGAGATATGTATTGAGTGACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2352s1c1
Sequence:CCGGCGAATTGGAATATGCTCTAAACTCGAGTTTAGAGCATATTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-211s1c1
Sequence:CCGGGCCTTCAGTAAAGTCAATTTACTCGAGTAAATTGACTTTACTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.1-2167s1c1
Sequence:CCGGCCTGAAGGAAGACCCGAATTTCTCGAGAAATTCGGGTCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015978.1-2129s1c1
Sequence:CCGGCCATATCATCTCTGCTGATACCTCGAGGTATCAGCAGAGATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.1-2725s1c1
Sequence:CCGGGATTTGTGCCTAAGGAATAATCTCGAGATTATTCCTTAGGCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-765s1c1
Sequence:CCGGACTCCATTTCTGTTCTCGATTCTCGAGAATCGAGAACAGAAATGGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015978.x-2874s1c1
Sequence:CCGGTGGGCTGAATTATGTAGACTTCTCGAGAAGTCTACATAATTCAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-2117s1c1
Sequence:CCGGCCATTCCCAAGCCCATATCATCTCGAGATGATATGGGCTTGGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1797s1c1
Sequence:CCGGGCCAATTATACATCGTGACTTCTCGAGAAGTCACGATGTATAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015978.x-1596s1c1
Sequence:CCGGGCTCAATCATCCCTGCGTAATCTCGAGATTACGCAGGGATGATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_487772
TNNI3K MISSION shRNA Bacterial Glycerol Stock
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-418s1c1
Sequence:CCGGGCCCTCCACATCGCTGCAATACTCGAGTATTGCAGCGATGTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-4151s1c1
Sequence:CCGGGAGATGTCACAGAACATCAAACTCGAGTTTGATGTTCTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-977s1c1
Sequence:CCGGCCAAGGAAATTGTCCACGTAACTCGAGTTACGTGGACAATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-1792s1c1
Sequence:CCGGCTTGACTTGCAGTCTAAATTACTCGAGTAATTTAGACTGCAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-2308s1c1
Sequence:CCGGGCTGACTCATACTGGTACAAACTCGAGTTTGTACCAGTATGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_487772
TNNI3K MISSION shRNA shRNA Plasmid DNA
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-418s1c1
Sequence:CCGGGCCCTCCACATCGCTGCAATACTCGAGTATTGCAGCGATGTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-4151s1c1
Sequence:CCGGGAGATGTCACAGAACATCAAACTCGAGTTTGATGTTCTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-977s1c1
Sequence:CCGGCCAAGGAAATTGTCCACGTAACTCGAGTTACGTGGACAATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-1792s1c1
Sequence:CCGGCTTGACTTGCAGTCTAAATTACTCGAGTAATTTAGACTGCAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-2308s1c1
Sequence:CCGGGCTGACTCATACTGGTACAAACTCGAGTTTGTACCAGTATGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_487772
TNNI3K MISSION shRNA Lentiviral Transduction Particles
TNNI3 interacting kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-418s1c1
Sequence:CCGGGCCCTCCACATCGCTGCAATACTCGAGTATTGCAGCGATGTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-4151s1c1
Sequence:CCGGGAGATGTCACAGAACATCAAACTCGAGTTTGATGTTCTGTGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-977s1c1
Sequence:CCGGCCAAGGAAATTGTCCACGTAACTCGAGTTACGTGGACAATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-1792s1c1
Sequence:CCGGCTTGACTTGCAGTCTAAATTACTCGAGTAATTTAGACTGCAAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487772.1-2308s1c1
Sequence:CCGGGCTGACTCATACTGGTACAAACTCGAGTTTGTACCAGTATGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks