EMAIL THIS PAGE TO A FRIEND

TNNT1

troponin T type 1 (skeletal, slow)

Synonyms: ANM NEM5 STNT TNT TNTS
UniProtKB ID: P13805, O95472, Q16061, Q5U0E1
Gene ID:
Human(7138) Summary: This gene encodes a protein that is a subunit of troponin, which is a regulatory complex located on the thin filament of the sarcomere. This complex regulates striated muscle contraction in response to fluctuations in intracellular calcium concentration. This complex is composed of three subunits: troponin C, which binds calcium, troponin T, which binds tropomyosin, and troponin I, which is an inhibitory subunit. This protein is the slow skeletal troponin T subunit. Mutations in this gene cause nemaline myopathy type 5, also known as Amish nemaline myopathy, a neuromuscular disorder characterized by muscle weakness and rod-shaped, or nemaline, inclusions in skeletal muscle fibers which affects infants, resulting in death due to respiratory insufficiency, usually in the second year. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21955) troponin T1, skeletal, slow
Rat(171409) troponin T type 1 (skeletal, slow)
Zebrafish(353248) troponin T1, skeletal, slow
domestic cat(101086360) troponin T type 1 (skeletal, slow)
dog(476383) troponin T type 1 (skeletal, slow)
cow(282095) troponin T type 1 (skeletal, slow)
sheep(101122212) troponin T type 1 (skeletal, slow)
domestic guinea pig(100720501) troponin T type 1 (skeletal, slow)
naked mole-rat(101713798) troponin T type 1 (skeletal, slow)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0748 Human TNNT1 / Troponin T, Slow Skeletal Muscle ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0581 AQUA Peptide VDFDDIH[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126132 Rosetta Predictions human pricing
NM_001126133 Rosetta Predictions human pricing
NM_003283 Rosetta Predictions human pricing
NM_134388 Rosetta Predictions rat pricing
NM_011618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328337 predicted 421
2 SASI_Hs02_00328338 predicted 420
3 SASI_Hs02_00328339 predicted 424
4 SASI_Hs02_00328340 predicted 459
5 SASI_Hs02_00328341 predicted 425
6 SASI_Hs02_00328342 predicted 451
7 SASI_Hs02_00328343 predicted 458
8 SASI_Hs02_00328344 predicted 417
9 SASI_Hs02_00328345 predicted 419
10 SASI_Hs02_00328346 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328347 predicted 388
2 SASI_Hs02_00328348 predicted 386
3 SASI_Hs02_00328349 predicted 393
4 SASI_Hs02_00328350 predicted 425
5 SASI_Hs02_00328351 predicted 395
6 SASI_Hs02_00328352 predicted 412
7 SASI_Hs02_00328353 predicted 424
8 SASI_Hs02_00328354 predicted 388
9 SASI_Hs02_00328355 predicted 387
10 SASI_Hs02_00328356 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244884 predicted 421
2 SASI_Hs01_00244885 predicted 419
3 SASI_Hs02_00335346 predicted 422
4 SASI_Hs02_00335347 predicted 459
5 SASI_Hs02_00335348 predicted 429
6 SASI_Hs02_00335349 predicted 449
7 SASI_Hs01_00244890 predicted 463
8 SASI_Hs01_00244893 predicted 415
9 SASI_Hs02_00335350 predicted 418
10 SASI_Hs02_00335351 predicted 453
11 SASI_Hs01_00244886 predicted 549
12 SASI_Hs01_00244887 predicted 611
13 SASI_Hs01_00244888 predicted 606
14 SASI_Hs01_00244889 predicted 365
15 SASI_Hs01_00244891 predicted 623
16 SASI_Hs01_00244892 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100558 predicted 641
2 SASI_Rn01_00100559 predicted 635
3 SASI_Rn01_00100560 predicted 642
4 SASI_Rn01_00100561 predicted 659
5 SASI_Rn01_00100562 predicted 659
6 SASI_Rn01_00100563 predicted 644
7 SASI_Rn01_00100564 predicted 640
8 SASI_Rn01_00100565 predicted 657
9 SASI_Rn01_00100566 predicted 634
10 SASI_Rn01_00100567 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120400 predicted 578
2 SASI_Mm01_00120401 predicted 324
3 SASI_Mm01_00120402 predicted 540
4 SASI_Mm02_00321056 predicted 300
5 SASI_Mm01_00120403 predicted 289
6 SASI_Mm01_00120404 predicted 505
7 SASI_Mm01_00120405 predicted 407
8 SASI_Mm01_00120406 predicted 328
9 SASI_Mm01_00120407 predicted 625
10 SASI_Mm01_00120408 predicted 572
11 SASI_Mm01_00120409 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003283
TNNT1 MISSION shRNA Bacterial Glycerol Stock
troponin T type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-630s1c1
Sequence:CCGGGCCTCTGGACATTGACTACATCTCGAGATGTAGTCAATGTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-198s1c1
Sequence:CCGGGCCTCCTTTGATCCCGCCAAACTCGAGTTTGGCGGGATCAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-234s1c1
Sequence:CCGGGCGCGTTGACTTCGATGACATCTCGAGATGTCATCGAAGTCAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-782s1c1
Sequence:CCGGCGAAGCTGAAACAGCAGAAATCTCGAGATTTCTGCTGTTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-289s1c1
Sequence:CCGGCTGCAGACACTCATCGATGTACTCGAGTACATCGATGAGTGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-443s21c1
Sequence:CCGGTGAGAAGGAACGCGAACGTCACTCGAGTGACGTTCGCGTTCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-341s21c1
Sequence:CCGGACATTTCGAGCAGCGGAAGAACTCGAGTTCTTCCGCTGCTCGAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-426s21c1
Sequence:CCGGCAACAGCGCTTCAGAACTGAGCTCGAGCTCAGTTCTGAAGCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003283
TNNT1 MISSION shRNA shRNA Plasmid DNA
troponin T type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-630s1c1
Sequence:CCGGGCCTCTGGACATTGACTACATCTCGAGATGTAGTCAATGTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-198s1c1
Sequence:CCGGGCCTCCTTTGATCCCGCCAAACTCGAGTTTGGCGGGATCAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-234s1c1
Sequence:CCGGGCGCGTTGACTTCGATGACATCTCGAGATGTCATCGAAGTCAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-782s1c1
Sequence:CCGGCGAAGCTGAAACAGCAGAAATCTCGAGATTTCTGCTGTTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-289s1c1
Sequence:CCGGCTGCAGACACTCATCGATGTACTCGAGTACATCGATGAGTGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-443s21c1
Sequence:CCGGTGAGAAGGAACGCGAACGTCACTCGAGTGACGTTCGCGTTCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-341s21c1
Sequence:CCGGACATTTCGAGCAGCGGAAGAACTCGAGTTCTTCCGCTGCTCGAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-426s21c1
Sequence:CCGGCAACAGCGCTTCAGAACTGAGCTCGAGCTCAGTTCTGAAGCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003283
TNNT1 MISSION shRNA Lentiviral Transduction Particles
troponin T type 1 (skeletal, slow)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-630s1c1
Sequence:CCGGGCCTCTGGACATTGACTACATCTCGAGATGTAGTCAATGTCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-198s1c1
Sequence:CCGGGCCTCCTTTGATCCCGCCAAACTCGAGTTTGGCGGGATCAAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-234s1c1
Sequence:CCGGGCGCGTTGACTTCGATGACATCTCGAGATGTCATCGAAGTCAACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-782s1c1
Sequence:CCGGCGAAGCTGAAACAGCAGAAATCTCGAGATTTCTGCTGTTTCAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003283.3-289s1c1
Sequence:CCGGCTGCAGACACTCATCGATGTACTCGAGTACATCGATGAGTGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-443s21c1
Sequence:CCGGTGAGAAGGAACGCGAACGTCACTCGAGTGACGTTCGCGTTCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-341s21c1
Sequence:CCGGACATTTCGAGCAGCGGAAGAACTCGAGTTCTTCCGCTGCTCGAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003283.4-426s21c1
Sequence:CCGGCAACAGCGCTTCAGAACTGAGCTCGAGCTCAGTTCTGAAGCGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011618
TNNT1 MISSION shRNA Bacterial Glycerol Stock
troponin T type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-626s1c1
Sequence:CCGGGCCCTTGAACATCGACTACATCTCGAGATGTAGTCGATGTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-740s1c1
Sequence:CCGGGCAACAGAAATATGAGATCAACTCGAGTTGATCTCATATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-303s1c1
Sequence:CCGGGTGCACTTTGAACAGCGGAAACTCGAGTTTCCGCTGTTCAAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-588s1c1
Sequence:CCGGCGGGAGATGAAACTCCGGATTCTCGAGAATCCGGAGTTTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-782s1c1
Sequence:CCGGCCACGCCCAGAAATTCCGAAACTCGAGTTTCGGAATTTCTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011618
TNNT1 MISSION shRNA shRNA Plasmid DNA
troponin T type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-626s1c1
Sequence:CCGGGCCCTTGAACATCGACTACATCTCGAGATGTAGTCGATGTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-740s1c1
Sequence:CCGGGCAACAGAAATATGAGATCAACTCGAGTTGATCTCATATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-303s1c1
Sequence:CCGGGTGCACTTTGAACAGCGGAAACTCGAGTTTCCGCTGTTCAAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-588s1c1
Sequence:CCGGCGGGAGATGAAACTCCGGATTCTCGAGAATCCGGAGTTTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-782s1c1
Sequence:CCGGCCACGCCCAGAAATTCCGAAACTCGAGTTTCGGAATTTCTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011618
TNNT1 MISSION shRNA Lentiviral Transduction Particles
troponin T type 1 (skeletal, slow)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-626s1c1
Sequence:CCGGGCCCTTGAACATCGACTACATCTCGAGATGTAGTCGATGTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-740s1c1
Sequence:CCGGGCAACAGAAATATGAGATCAACTCGAGTTGATCTCATATTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-303s1c1
Sequence:CCGGGTGCACTTTGAACAGCGGAAACTCGAGTTTCCGCTGTTCAAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-588s1c1
Sequence:CCGGCGGGAGATGAAACTCCGGATTCTCGAGAATCCGGAGTTTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011618.1-782s1c1
Sequence:CCGGCCACGCCCAGAAATTCCGAAACTCGAGTTTCGGAATTTCTGGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks