EMAIL THIS PAGE TO A FRIEND

TNNT2

troponin T type 2 (cardiac)

Synonyms: CMH2 CMPD2 LVNC6 RCM3 TnTC cTnT
Gene ID:
Human(7139) Summary: The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(21956) troponin T2, cardiac
Rat(24837) troponin T type 2 (cardiac)
naked mole-rat(101722846) troponin T type 2 (cardiac)
Domestic Rabbit(100009428) troponin T type 2 (cardiac)
domestic guinea pig(100379561) troponin T2, cardiac
cow(286816) troponin T type 2 (cardiac)
chicken(396433) troponin T type 2 (cardiac)
domestic cat(493940) troponin T type 2 (cardiac)
dog(403532) troponin T type 2 (cardiac)
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502131 Anti-TNNT2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, pig, cat, mouse, canine
ELISA, western blot pricing
SAB1406542 Anti-TNNT2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108239 Anti-TNNT2 antibody produced in rabbit affinity isolated antibody zebrafish, pig, bovine, canine, human, rat, guinea pig, mouse, rabbit, horse
western blot pricing
HPA015774 Anti-TNNT2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA017888 Anti-TNNT2 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411359 Anti-TNNT2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB5300190 Monoclonal Anti-TNNT2 antibody produced in mouse clone 1G1, ascites fluid human
ELISA, flow cytometry, western blot pricing
SAB1402378 Monoclonal Anti-TNNT2, (N-terminal) antibody produced in mouse clone 3H4-F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
T6277 Monoclonal Anti-Troponin T antibody produced in mouse clone JLT-12, ascites fluid rabbit, bovine, rat, chicken
immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0581 AQUA Peptide VDFDDIH[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123401 MISSION® esiRNA esiRNA human TNNT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000364 Rosetta Predictions human pricing
NM_001001430 Rosetta Predictions human pricing
NM_001001431 Rosetta Predictions human pricing
NM_001001432 Rosetta Predictions human pricing
NM_012676 Rosetta Predictions rat pricing
NM_001130174 Rosetta Predictions mouse pricing
NM_001130175 Rosetta Predictions mouse pricing
NM_001130176 Rosetta Predictions mouse pricing
NM_001130177 Rosetta Predictions mouse pricing
NM_001130178 Rosetta Predictions mouse pricing
NM_001130179 Rosetta Predictions mouse pricing
NM_001130180 Rosetta Predictions mouse pricing
NM_001130181 Rosetta Predictions mouse pricing
NM_011619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175236 predicted 910
2 SASI_Hs01_00175237 predicted 907
3 SASI_Hs01_00175239 predicted 917
4 SASI_Hs01_00175240 predicted 907
5 SASI_Hs01_00175241 predicted 879
6 SASI_Hs01_00175242 predicted 883
7 SASI_Hs01_00175243 predicted 893
8 SASI_Hs01_00175244 predicted 914
9 SASI_Hs01_00175245 predicted 910
10 SASI_Hs02_00302415 predicted 929
11 SASI_Hs01_00175238 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199196 predicted 893
2 SASI_Hs01_00199197 predicted 879
3 SASI_Hs01_00199199 predicted 893
4 SASI_Hs01_00199200 predicted 893
5 SASI_Hs01_00199201 predicted 860
6 SASI_Hs01_00199202 predicted 865
7 SASI_Hs01_00199203 predicted 867
8 SASI_Hs01_00199204 predicted 894
9 SASI_Hs01_00199205 predicted 886
10 SASI_Hs02_00303770 predicted 905
11 SASI_Hs01_00199198 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040409 predicted 880
2 SASI_Hs01_00040410 predicted 873
3 SASI_Hs01_00040412 predicted 885
4 SASI_Hs01_00040413 predicted 885
5 SASI_Hs01_00040414 predicted 844
6 SASI_Hs01_00040415 predicted 848
7 SASI_Hs01_00040416 predicted 865
8 SASI_Hs01_00040417 predicted 885
9 SASI_Hs01_00040418 predicted 878
10 SASI_Hs02_00303771 predicted 903
11 SASI_Hs01_00040411 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120876 predicted 874
2 SASI_Hs01_00120877 predicted 861
3 SASI_Hs01_00120879 predicted 875
4 SASI_Hs01_00120880 predicted 877
5 SASI_Hs01_00120881 predicted 842
6 SASI_Hs01_00120882 predicted 839
7 SASI_Hs01_00120883 predicted 854
8 SASI_Hs01_00120884 predicted 879
9 SASI_Hs01_00120885 predicted 873
10 SASI_Hs02_00303772 predicted 892
11 SASI_Hs01_00120878 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081866 predicted 249
2 SASI_Rn01_00081867 predicted 229
3 SASI_Rn01_00081868 predicted 281
4 SASI_Rn01_00081870 predicted 247
5 SASI_Rn01_00081871 predicted 871
6 SASI_Rn01_00081872 predicted 346
7 SASI_Rn01_00081873 predicted 237
8 SASI_Rn01_00081874 predicted 263
9 SASI_Rn02_00259961 predicted 348
10 SASI_Rn02_00259962 predicted 214
11 SASI_Rn01_00081865 predicted 280
12 SASI_Rn01_00081869 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310968 predicted 364
2 SASI_Mm02_00310969 predicted 364
3 SASI_Mm02_00310970 predicted 477
4 SASI_Mm02_00310971 predicted 402
5 SASI_Mm02_00310972 predicted 400
6 SASI_Mm02_00310973 predicted 403
7 SASI_Mm02_00310974 predicted 432
8 SASI_Mm02_00310975 predicted 418
9 SASI_Mm02_00310976 predicted 395
10 SASI_Mm02_00310977 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310978 predicted 357
2 SASI_Mm02_00310979 predicted 367
3 SASI_Mm02_00310980 predicted 397
4 SASI_Mm02_00310981 predicted 398
5 SASI_Mm02_00310982 predicted 398
6 SASI_Mm02_00310983 predicted 424
7 SASI_Mm02_00310984 predicted 405
8 SASI_Mm02_00310985 predicted 391
9 SASI_Mm02_00310986 predicted 392
10 SASI_Mm02_00310987 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310988 predicted 307
2 SASI_Mm02_00310989 predicted 309
3 SASI_Mm02_00310990 predicted 411
4 SASI_Mm02_00310991 predicted 338
5 SASI_Mm02_00310992 predicted 345
6 SASI_Mm02_00310993 predicted 344
7 SASI_Mm02_00310994 predicted 367
8 SASI_Mm02_00310995 predicted 352
9 SASI_Mm02_00310996 predicted 333
10 SASI_Mm02_00310997 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310998 predicted 349
2 SASI_Mm02_00310999 predicted 357
3 SASI_Mm02_00311000 predicted 391
4 SASI_Mm02_00311001 predicted 394
5 SASI_Mm02_00311002 predicted 387
6 SASI_Mm02_00311003 predicted 422
7 SASI_Mm02_00311004 predicted 404
8 SASI_Mm02_00311005 predicted 384
9 SASI_Mm02_00311006 predicted 378
10 SASI_Mm02_00311007 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311008 predicted 333
2 SASI_Mm02_00311009 predicted 338
3 SASI_Mm02_00311010 predicted 438
4 SASI_Mm02_00311011 predicted 371
5 SASI_Mm02_00311012 predicted 374
6 SASI_Mm02_00311013 predicted 372
7 SASI_Mm02_00311014 predicted 404
8 SASI_Mm02_00311015 predicted 387
9 SASI_Mm02_00311016 predicted 361
10 SASI_Mm02_00311017 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311018 predicted 334
2 SASI_Mm02_00311019 predicted 338
3 SASI_Mm02_00311020 predicted 435
4 SASI_Mm02_00311021 predicted 368
5 SASI_Mm02_00311022 predicted 370
6 SASI_Mm02_00311023 predicted 363
7 SASI_Mm02_00311024 predicted 397
8 SASI_Mm02_00311025 predicted 383
9 SASI_Mm02_00311026 predicted 358
10 SASI_Mm02_00311027 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311028 predicted 427
2 SASI_Mm02_00311029 predicted 364
3 SASI_Mm02_00311030 predicted 356
4 SASI_Mm02_00311031 predicted 358
5 SASI_Mm02_00311032 predicted 390
6 SASI_Mm02_00311033 predicted 372
7 SASI_Mm02_00311034 predicted 354
8 SASI_Mm02_00311035 predicted 351
9 SASI_Mm02_00311036 predicted 398
10 SASI_Mm02_00311037 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311038 predicted 426
2 SASI_Mm02_00311039 predicted 352
3 SASI_Mm02_00311040 predicted 358
4 SASI_Mm02_00311041 predicted 354
5 SASI_Mm02_00311042 predicted 388
6 SASI_Mm02_00311043 predicted 368
7 SASI_Mm02_00311044 predicted 347
8 SASI_Mm02_00311045 predicted 346
9 SASI_Mm02_00311046 predicted 390
10 SASI_Mm02_00311047 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069019 predicted 357
2 SASI_Mm01_00069020 predicted 361
3 SASI_Mm02_00321057 predicted 358
4 SASI_Mm01_00069022 predicted 391
5 SASI_Mm01_00069023 predicted 374
6 SASI_Mm02_00321058 predicted 358
7 SASI_Mm02_00321059 predicted 347
8 SASI_Mm02_00321060 predicted 401
9 SASI_Mm02_00321061 predicted 391
10 SASI_Mm02_00321062 predicted 349
11 SASI_Mm01_00069014 predicted 419
12 SASI_Mm01_00069015 predicted 416
13 SASI_Mm01_00069016 predicted 419
14 SASI_Mm01_00069017 predicted 420
15 SASI_Mm01_00069018 predicted 426
16 SASI_Mm01_00069021 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000364
TNNT2 MISSION shRNA Bacterial Glycerol Stock
troponin T type 2 (cardiac)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-868s21c1
Sequence:CCGGGAGATCAATGTTCTCCGAAACCTCGAGGTTTCGGAGAACATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-291s21c1
Sequence:CCGGACCAAAGCCCAGGTCGTTCATCTCGAGATGAACGACCTGGGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-467s21c1
Sequence:CCGCTCAAAGACAGGATCGAGAGACCTCGAGGTCTCTCGATCCTGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-754s21c1
Sequence:CCGGGACCACCTGAATGAAGATCAGCTCGAGCTGATCTTCATTCAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-857s1c1
Sequence:CCGGCGATAACCAGAAAGTCTCCAACTCGAGTTGGAGACTTTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-290s1c1
Sequence:CCGGCGATGGAGAGAGAGTGGACTTCTCGAGAAGTCCACTCTCTCTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-761s1c1
Sequence:CCGGGCAGAGCATCTATAACTTGGACTCGAGTCCAAGTTATAGATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-360s1c1
Sequence:CCGGGCGCTGATTGAGGCTCACTTTCTCGAGAAAGTGAGCCTCAATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-575s1c1
Sequence:CCGGGAAGGCTTTGTCCAACATGATCTCGAGATCATGTTGGACAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000364
TNNT2 MISSION shRNA shRNA Plasmid DNA
troponin T type 2 (cardiac)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-868s21c1
Sequence:CCGGGAGATCAATGTTCTCCGAAACCTCGAGGTTTCGGAGAACATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-291s21c1
Sequence:CCGGACCAAAGCCCAGGTCGTTCATCTCGAGATGAACGACCTGGGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-467s21c1
Sequence:CCGCTCAAAGACAGGATCGAGAGACCTCGAGGTCTCTCGATCCTGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-754s21c1
Sequence:CCGGGACCACCTGAATGAAGATCAGCTCGAGCTGATCTTCATTCAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-857s1c1
Sequence:CCGGCGATAACCAGAAAGTCTCCAACTCGAGTTGGAGACTTTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-290s1c1
Sequence:CCGGCGATGGAGAGAGAGTGGACTTCTCGAGAAGTCCACTCTCTCTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-761s1c1
Sequence:CCGGGCAGAGCATCTATAACTTGGACTCGAGTCCAAGTTATAGATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-360s1c1
Sequence:CCGGGCGCTGATTGAGGCTCACTTTCTCGAGAAAGTGAGCCTCAATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-575s1c1
Sequence:CCGGGAAGGCTTTGTCCAACATGATCTCGAGATCATGTTGGACAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000364
TNNT2 MISSION shRNA Lentiviral Transduction Particles
troponin T type 2 (cardiac)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-868s21c1
Sequence:CCGGGAGATCAATGTTCTCCGAAACCTCGAGGTTTCGGAGAACATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-291s21c1
Sequence:CCGGACCAAAGCCCAGGTCGTTCATCTCGAGATGAACGACCTGGGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-467s21c1
Sequence:CCGCTCAAAGACAGGATCGAGAGACCTCGAGGTCTCTCGATCCTGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000364.2-754s21c1
Sequence:CCGGGACCACCTGAATGAAGATCAGCTCGAGCTGATCTTCATTCAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-857s1c1
Sequence:CCGGCGATAACCAGAAAGTCTCCAACTCGAGTTGGAGACTTTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-290s1c1
Sequence:CCGGCGATGGAGAGAGAGTGGACTTCTCGAGAAGTCCACTCTCTCTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-761s1c1
Sequence:CCGGGCAGAGCATCTATAACTTGGACTCGAGTCCAAGTTATAGATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-360s1c1
Sequence:CCGGGCGCTGATTGAGGCTCACTTTCTCGAGAAAGTGAGCCTCAATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000364.1-575s1c1
Sequence:CCGGGAAGGCTTTGTCCAACATGATCTCGAGATCATGTTGGACAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011619
VALIDATED
TNNT2 MISSION shRNA Bacterial Glycerol Stock
troponin T type 2 (cardiac)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-840s21c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-449s21c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-874s21c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011619.2-945s21c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-926s1c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-855s1c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-430s1c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011619.1-597s1c1
Sequence:CCGGCTGTCCAACATGATGCACTTTCTCGAGAAAGTGCATCATGTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-821s1c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011619
VALIDATED
TNNT2 MISSION shRNA shRNA Plasmid DNA
troponin T type 2 (cardiac)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-840s21c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-449s21c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-874s21c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011619.2-945s21c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-926s1c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-855s1c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-430s1c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011619.1-597s1c1
Sequence:CCGGCTGTCCAACATGATGCACTTTCTCGAGAAAGTGCATCATGTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-821s1c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011619
VALIDATED
TNNT2 MISSION shRNA Lentiviral Transduction Particles
troponin T type 2 (cardiac)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-840s21c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-449s21c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011619.2-874s21c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011619.2-945s21c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-926s1c1
Sequence:CCGGGAAACTGTTCTCGTCAAAGCTCTCGAGAGCTTTGACGAGAACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-855s1c1
Sequence:CCGGCGGATCAATGACAACCAGAAACTCGAGTTTCTGGTTGTCATTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-430s1c1
Sequence:CCGGCCCTCAAAGACAGGATCGAAACTCGAGTTTCGATCCTGTCTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011619.1-597s1c1
Sequence:CCGGCTGTCCAACATGATGCACTTTCTCGAGAAAGTGCATCATGTTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011619.1-821s1c1
Sequence:CCGGGCAGCAGAAATACGAAATCAACTCGAGTTGATTTCGTATTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks