EMAIL THIS PAGE TO A FRIEND

TNNT3

troponin T type 3 (skeletal, fast)

Synonyms: TNTF
Gene ID:
Human(7140) Summary: The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
Mouse(21957) troponin T3, skeletal, fast
Rat(24838) troponin T type 3 (skeletal, fast)
chicken(395761) troponin T type 3 (skeletal, fast)
dog(475996) troponin T type 3 (skeletal, fast)
domestic cat(101091149) troponin T type 3 (skeletal, fast)
cow(282096) troponin T type 3 (skeletal, fast)
sheep(101104467) troponin T type 3 (skeletal, fast)
Goat(100861247) troponin T type 3 (skeletal, fast)
domestic guinea pig(100734707) troponin T type 3 (skeletal, fast)
Domestic Rabbit(100009527) troponin T type 3 (skeletal, fast)
naked mole-rat(101718573) troponin T type 3 (skeletal, fast)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006757 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133711 MISSION® esiRNA esiRNA human TNNT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042780 Rosetta Predictions human pricing
NM_001042781 Rosetta Predictions human pricing
NM_001042782 Rosetta Predictions human pricing
NM_006757 Rosetta Predictions human pricing
NM_031532 Rosetta Predictions rat pricing
NM_011620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311199 predicted 587
2 SASI_Hs02_00311200 predicted 521
3 SASI_Hs02_00311201 predicted 592
4 SASI_Hs02_00311202 predicted 626
5 SASI_Hs02_00311203 predicted 522
6 SASI_Hs02_00311204 predicted 620
7 SASI_Hs02_00311205 predicted 498
8 SASI_Hs02_00311206 predicted 613
9 SASI_Hs02_00311207 predicted 504
10 SASI_Hs02_00311208 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311209 predicted 604
2 SASI_Hs02_00311210 predicted 540
3 SASI_Hs02_00311211 predicted 612
4 SASI_Hs02_00311212 predicted 637
5 SASI_Hs02_00311213 predicted 537
6 SASI_Hs02_00311214 predicted 637
7 SASI_Hs02_00311215 predicted 516
8 SASI_Hs02_00311216 predicted 632
9 SASI_Hs02_00311217 predicted 521
10 SASI_Hs02_00311218 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311219 predicted 587
2 SASI_Hs02_00311220 predicted 528
3 SASI_Hs02_00311221 predicted 591
4 SASI_Hs02_00311222 predicted 619
5 SASI_Hs02_00311223 predicted 526
6 SASI_Hs02_00311224 predicted 615
7 SASI_Hs02_00311225 predicted 504
8 SASI_Hs02_00311226 predicted 612
9 SASI_Hs02_00311227 predicted 505
10 SASI_Hs02_00311228 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342235 predicted 616
2 SASI_Hs02_00342236 predicted 548
3 SASI_Hs01_00241590 predicted 621
4 SASI_Hs02_00342237 predicted 652
5 SASI_Hs02_00342238 predicted 548
6 SASI_Hs02_00342239 predicted 643
7 SASI_Hs01_00241597 predicted 522
8 SASI_Hs02_00342240 predicted 635
9 SASI_Hs02_00342241 predicted 533
10 SASI_Hs02_00342242 predicted 557
11 SASI_Hs01_00241588 predicted 569
12 SASI_Hs01_00241589 predicted 520
13 SASI_Hs01_00241591 predicted 554
14 SASI_Hs01_00241592 predicted 673
15 SASI_Hs01_00241593 predicted 662
16 SASI_Hs01_00241594 predicted 491
17 SASI_Hs01_00241595 predicted 641
18 SASI_Hs01_00241596 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099903 predicted 537
2 SASI_Rn01_00099904 predicted 530
3 SASI_Rn01_00099905 predicted 388
4 SASI_Rn02_00264683 predicted 419
5 SASI_Rn01_00099907 predicted 422
6 SASI_Rn01_00099908 predicted 494
7 SASI_Rn01_00099910 predicted 547
8 SASI_Rn01_00099911 predicted 381
9 SASI_Rn01_00099912 predicted 454
10 SASI_Rn02_00264684 predicted 334
11 SASI_Rn01_00099906 predicted 399
12 SASI_Rn01_00099909 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103757 predicted 301
2 SASI_Mm01_00103758 predicted 273
3 SASI_Mm01_00103759 predicted 544
4 SASI_Mm02_00321063 predicted 651
5 SASI_Mm01_00103760 predicted 589
6 SASI_Mm01_00103761 predicted 300
7 SASI_Mm01_00103762 predicted 518
8 SASI_Mm01_00103763 predicted 653
9 SASI_Mm01_00103764 predicted 599
10 SASI_Mm01_00103765 predicted 691
11 SASI_Mm01_00103756 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006757
TNNT3 MISSION shRNA Bacterial Glycerol Stock
troponin T type 3 (skeletal, fast)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-198s1c1
Sequence:CCGGGCGTCAGAACAAAGACCTAATCTCGAGATTAGGTCTTTGTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-134s1c1
Sequence:CCGGCCAAACTCACTGCTCCTAAGACTCGAGTCTTAGGAGCAGTGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-675s1c1
Sequence:CCGGGAAACGCCAGAAATATGACATCTCGAGATGTCATATTTCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-524s1c1
Sequence:CCGGCCCGAGAGATGAAGAAGAAGACTCGAGTCTTCTTCTTCATCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-526s1c1
Sequence:CCGGCGAGAGATGAAGAAGAAGATTCTCGAGAATCTTCTTCTTCATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-565s21c1
Sequence:CCGGAGAACAGACTGGCGGAGGAAACTCGAGTTTCCTCCGCCAGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-844s21c1
Sequence:CCGGAGATTGACAAGTTCGAGTTTGCTCGAGCAAACTCGAACTTGTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-761s21c1
Sequence:CCGGCAAGCCGCTCAACATCGATCACTCGAGTGATCGATGTTGAGCGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006757
TNNT3 MISSION shRNA shRNA Plasmid DNA
troponin T type 3 (skeletal, fast)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-198s1c1
Sequence:CCGGGCGTCAGAACAAAGACCTAATCTCGAGATTAGGTCTTTGTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-134s1c1
Sequence:CCGGCCAAACTCACTGCTCCTAAGACTCGAGTCTTAGGAGCAGTGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-675s1c1
Sequence:CCGGGAAACGCCAGAAATATGACATCTCGAGATGTCATATTTCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-524s1c1
Sequence:CCGGCCCGAGAGATGAAGAAGAAGACTCGAGTCTTCTTCTTCATCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-526s1c1
Sequence:CCGGCGAGAGATGAAGAAGAAGATTCTCGAGAATCTTCTTCTTCATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-565s21c1
Sequence:CCGGAGAACAGACTGGCGGAGGAAACTCGAGTTTCCTCCGCCAGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-844s21c1
Sequence:CCGGAGATTGACAAGTTCGAGTTTGCTCGAGCAAACTCGAACTTGTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-761s21c1
Sequence:CCGGCAAGCCGCTCAACATCGATCACTCGAGTGATCGATGTTGAGCGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006757
TNNT3 MISSION shRNA Lentiviral Transduction Particles
troponin T type 3 (skeletal, fast)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-198s1c1
Sequence:CCGGGCGTCAGAACAAAGACCTAATCTCGAGATTAGGTCTTTGTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-134s1c1
Sequence:CCGGCCAAACTCACTGCTCCTAAGACTCGAGTCTTAGGAGCAGTGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-675s1c1
Sequence:CCGGGAAACGCCAGAAATATGACATCTCGAGATGTCATATTTCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-524s1c1
Sequence:CCGGCCCGAGAGATGAAGAAGAAGACTCGAGTCTTCTTCTTCATCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006757.1-526s1c1
Sequence:CCGGCGAGAGATGAAGAAGAAGATTCTCGAGAATCTTCTTCTTCATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-565s21c1
Sequence:CCGGAGAACAGACTGGCGGAGGAAACTCGAGTTTCCTCCGCCAGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-844s21c1
Sequence:CCGGAGATTGACAAGTTCGAGTTTGCTCGAGCAAACTCGAACTTGTCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006757.3-761s21c1
Sequence:CCGGCAAGCCGCTCAACATCGATCACTCGAGTGATCGATGTTGAGCGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011620
TNNT3 MISSION shRNA Bacterial Glycerol Stock
troponin T type 3 (skeletal, fast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-598s1c1
Sequence:CCGGCCTCTGAACATTGACCATCTTCTCGAGAAGATGGTCAATGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-363s1c1
Sequence:CCGGGCAAAGAATTCGCGCTGAGAACTCGAGTTCTCAGCGCGAATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-165s1c1
Sequence:CCGGACCCAAACTTACTGCTCCTAACTCGAGTTAGGAGCAGTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-304s1c1
Sequence:CCGGGAGGAGCTAATCGCACTTAAACTCGAGTTTAAGTGCGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-275s1c1
Sequence:CCGGGCCACTTTGAAGCTAGAAAGACTCGAGTCTTTCTAGCTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011620
TNNT3 MISSION shRNA shRNA Plasmid DNA
troponin T type 3 (skeletal, fast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-598s1c1
Sequence:CCGGCCTCTGAACATTGACCATCTTCTCGAGAAGATGGTCAATGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-363s1c1
Sequence:CCGGGCAAAGAATTCGCGCTGAGAACTCGAGTTCTCAGCGCGAATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-165s1c1
Sequence:CCGGACCCAAACTTACTGCTCCTAACTCGAGTTAGGAGCAGTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-304s1c1
Sequence:CCGGGAGGAGCTAATCGCACTTAAACTCGAGTTTAAGTGCGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-275s1c1
Sequence:CCGGGCCACTTTGAAGCTAGAAAGACTCGAGTCTTTCTAGCTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011620
TNNT3 MISSION shRNA Lentiviral Transduction Particles
troponin T type 3 (skeletal, fast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-598s1c1
Sequence:CCGGCCTCTGAACATTGACCATCTTCTCGAGAAGATGGTCAATGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-363s1c1
Sequence:CCGGGCAAAGAATTCGCGCTGAGAACTCGAGTTCTCAGCGCGAATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-165s1c1
Sequence:CCGGACCCAAACTTACTGCTCCTAACTCGAGTTAGGAGCAGTAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-304s1c1
Sequence:CCGGGAGGAGCTAATCGCACTTAAACTCGAGTTTAAGTGCGATTAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011620.1-275s1c1
Sequence:CCGGGCCACTTTGAAGCTAGAAAGACTCGAGTCTTTCTAGCTTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks