EMAIL THIS PAGE TO A FRIEND

TNP1

transition protein 1 (during histone to protamine replacement)

Synonyms: TP1
UniProtKB ID: P09430
Gene ID:
Human(7141) Summary: Transition protein-1 is a spermatid-specific product of the haploid genome which replaces histone and is itself replaced in the mature sperm by the protamines (see PRM1, MIM 182880; PRM2, MIM 182890) (Luerssen et al., 1990 [PubMed 2249851]
Mouse(21958) transition protein 1
Rat(24839) transition protein 1
cow(281537) transition protein 1 (during histone to protamine replacement)
sheep(101108026) transition protein 1 (during histone to protamine replacement)
Domestic Rabbit(100349146) transition protein 1 (during histone to protamine replacement)
domestic guinea pig(100724147) transition protein 1 (during histone to protamine replacement)
Horse(100630835) transition protein 1 (during histone to protamine replacement)
dog(100686780) transition protein 1 (during histone to protamine replacement)
domestic cat(101084562) transition protein 1 (during histone to protamine replacement)
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057051 MISSION® esiRNA esiRNA human TNP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003284 Rosetta Predictions human pricing
NM_017056 Rosetta Predictions rat pricing
NM_009407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242940 predicted 333
2 SASI_Hs01_00242941 predicted 304
3 SASI_Hs01_00242942 predicted 317
4 SASI_Hs01_00242943 predicted 324
5 SASI_Hs01_00242945 predicted 74
6 SASI_Hs01_00242946 predicted 292
7 SASI_Hs01_00242947 predicted 327
8 SASI_Hs01_00242948 predicted 163
9 SASI_Hs01_00242949 predicted 169
10 SASI_Hs02_00335352 predicted 260
11 SASI_Hs01_00242944 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089923 predicted 316
2 SASI_Rn01_00089924 predicted 327
3 SASI_Rn01_00089925 predicted 147
4 SASI_Rn01_00089926 predicted 195
5 SASI_Rn01_00089927 predicted 176
6 SASI_Rn01_00089928 predicted 47
7 SASI_Rn01_00089929 predicted 190
8 SASI_Rn01_00089930 predicted 151
9 SASI_Rn01_00089931 predicted 310
10 SASI_Rn02_00261247 predicted 286
11 SASI_Rn01_00089932 predicted 77
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077875 predicted 338
2 SASI_Mm01_00077876 predicted 323
3 SASI_Mm01_00077877 predicted 270
4 SASI_Mm01_00077878 predicted 347
5 SASI_Mm01_00077879 predicted 279
6 SASI_Mm01_00077880 predicted 160
7 SASI_Mm01_00077881 predicted 334
8 SASI_Mm02_00316046 predicted 304
9 SASI_Mm01_00077882 predicted 53
10 SASI_Mm01_00077883 predicted 178
11 SASI_Mm01_00077884 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003284
TNP1 MISSION shRNA Bacterial Glycerol Stock
transition protein 1 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-95s21c1
Sequence:CCGGGTCAAGAGAGGTGGCAGCAAACTCGAGTTTGCTGCCACCTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-121s21c1
Sequence:CCGGATACCGTAAGGGCAACCTGAACTCGAGTTCAGGTTGCCCTTACGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003284.3-217s21c1
Sequence:CCGGTGCGCTTCACACAGCACCAAGCTCGAGCTTGGTGCTGTGTGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073283    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003284.2-336s1c1
Sequence:CCGGGCCTATGGAATGTGGATCAAACTCGAGTTTGATCCACATTCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-173s1c1
Sequence:CCGGTCGCAATTACCGCTCCCACTTCTCGAGAAGTGGGAGCGGTAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-74s1c1
Sequence:CCGGCAAGAGCCGATCTCCTCACAACTCGAGTTGTGAGGAGATCGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-56s1c1
Sequence:CCGGTCATGGCATGAGGAGGAGCAACTCGAGTTGCTCCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003284
TNP1 MISSION shRNA shRNA Plasmid DNA
transition protein 1 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-95s21c1
Sequence:CCGGGTCAAGAGAGGTGGCAGCAAACTCGAGTTTGCTGCCACCTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-121s21c1
Sequence:CCGGATACCGTAAGGGCAACCTGAACTCGAGTTCAGGTTGCCCTTACGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003284.3-217s21c1
Sequence:CCGGTGCGCTTCACACAGCACCAAGCTCGAGCTTGGTGCTGTGTGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073283    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003284.2-336s1c1
Sequence:CCGGGCCTATGGAATGTGGATCAAACTCGAGTTTGATCCACATTCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-173s1c1
Sequence:CCGGTCGCAATTACCGCTCCCACTTCTCGAGAAGTGGGAGCGGTAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-74s1c1
Sequence:CCGGCAAGAGCCGATCTCCTCACAACTCGAGTTGTGAGGAGATCGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-56s1c1
Sequence:CCGGTCATGGCATGAGGAGGAGCAACTCGAGTTGCTCCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003284
TNP1 MISSION shRNA Lentiviral Transduction Particles
transition protein 1 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-95s21c1
Sequence:CCGGGTCAAGAGAGGTGGCAGCAAACTCGAGTTTGCTGCCACCTCTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003284.3-121s21c1
Sequence:CCGGATACCGTAAGGGCAACCTGAACTCGAGTTCAGGTTGCCCTTACGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003284.3-217s21c1
Sequence:CCGGTGCGCTTCACACAGCACCAAGCTCGAGCTTGGTGCTGTGTGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073283    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003284.2-336s1c1
Sequence:CCGGGCCTATGGAATGTGGATCAAACTCGAGTTTGATCCACATTCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-173s1c1
Sequence:CCGGTCGCAATTACCGCTCCCACTTCTCGAGAAGTGGGAGCGGTAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-74s1c1
Sequence:CCGGCAAGAGCCGATCTCCTCACAACTCGAGTTGTGAGGAGATCGGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003284.2-56s1c1
Sequence:CCGGTCATGGCATGAGGAGGAGCAACTCGAGTTGCTCCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009407
TNP1 MISSION shRNA Bacterial Glycerol Stock
transition protein 1 (during histone to protamine replacement)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-83s1c1
Sequence:CCGGAGAGAGGTGGAAGCAAGAGAACTCGAGTTCTCTTGCTTCCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-36s1c1
Sequence:CCGGTCATGGCATGAGGAGAGGCAACTCGAGTTGCCTCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-140s1c1
Sequence:CCGGGCGATGATGCAAGTCGCAATTCTCGAGAATTGCGACTTGCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009407.1-194s1c1
Sequence:CCGGGCCCTGGTGGTCTTCAAACAACTCGAGTTGTTTGAAGACCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-155s1c1
Sequence:CCGGGCAATTACCGATCCCACTTGTCTCGAGACAAGTGGGATCGGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009407
TNP1 MISSION shRNA shRNA Plasmid DNA
transition protein 1 (during histone to protamine replacement)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-83s1c1
Sequence:CCGGAGAGAGGTGGAAGCAAGAGAACTCGAGTTCTCTTGCTTCCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-36s1c1
Sequence:CCGGTCATGGCATGAGGAGAGGCAACTCGAGTTGCCTCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-140s1c1
Sequence:CCGGGCGATGATGCAAGTCGCAATTCTCGAGAATTGCGACTTGCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009407.1-194s1c1
Sequence:CCGGGCCCTGGTGGTCTTCAAACAACTCGAGTTGTTTGAAGACCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-155s1c1
Sequence:CCGGGCAATTACCGATCCCACTTGTCTCGAGACAAGTGGGATCGGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009407
TNP1 MISSION shRNA Lentiviral Transduction Particles
transition protein 1 (during histone to protamine replacement)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-83s1c1
Sequence:CCGGAGAGAGGTGGAAGCAAGAGAACTCGAGTTCTCTTGCTTCCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-36s1c1
Sequence:CCGGTCATGGCATGAGGAGAGGCAACTCGAGTTGCCTCTCCTCATGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-140s1c1
Sequence:CCGGGCGATGATGCAAGTCGCAATTCTCGAGAATTGCGACTTGCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009407.1-194s1c1
Sequence:CCGGGCCCTGGTGGTCTTCAAACAACTCGAGTTGTTTGAAGACCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009407.1-155s1c1
Sequence:CCGGGCAATTACCGATCCCACTTGTCTCGAGACAAGTGGGATCGGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks