EMAIL THIS PAGE TO A FRIEND

TNP2

transition protein 2 (during histone to protamine replacement)

Synonyms: TP2
UniProtKB ID: Q05952, Q9NZB0
Gene ID:
Mouse(21959) transition protein 2
Rat(24840) transition protein 2
Horse(100189599) transition protein 2 (during histone to protamine replacement)
domestic cat(101084334) transition protein 2 (during histone to protamine replacement)
dog(479849) transition protein 2 (during histone to protamine replacement)
domestic guinea pig(101789237) transition protein 2 (during histone to protamine replacement)
cow(281538) transition protein 2 (during histone to protamine replacement)
sheep(101108877) transition protein 2 (during histone to protamine replacement)
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302668 ANTI-TNP2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073641 MISSION® esiRNA esiRNA targeting mouse Tnp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005425 Rosetta Predictions human pricing
NM_017057 Rosetta Predictions rat pricing
NM_013694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202747 predicted 433
2 SASI_Hs01_00202748 predicted 76
3 SASI_Hs01_00202749 predicted 516
4 SASI_Hs01_00202750 predicted 530
5 SASI_Hs01_00202751 predicted 47
6 SASI_Hs01_00202752 predicted 474
7 SASI_Hs01_00202753 predicted 505
8 SASI_Hs01_00202754 predicted 530
9 SASI_Hs01_00202755 predicted 535
10 SASI_Hs01_00202756 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030553 predicted 289
2 SASI_Rn01_00030554 predicted 232
3 SASI_Rn01_00030555 predicted 242
4 SASI_Rn01_00030556 predicted 294
5 SASI_Rn01_00030557 predicted 304
6 SASI_Rn01_00030558 predicted 241
7 SASI_Rn01_00030559 predicted 296
8 SASI_Rn01_00030560 predicted 233
9 SASI_Rn01_00030561 predicted 202
10 SASI_Rn01_00030562 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023237 predicted 243
2 SASI_Mm01_00023238 predicted 206
3 SASI_Mm02_00322584 predicted 300
4 SASI_Mm01_00023239 predicted 310
5 SASI_Mm01_00023240 predicted 206
6 SASI_Mm01_00023241 predicted 261
7 SASI_Mm01_00023242 predicted 251
8 SASI_Mm01_00023243 predicted 238
9 SASI_Mm01_00023244 predicted 300
10 SASI_Mm01_00023245 predicted 318
11 SASI_Mm01_00023246 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013694
TNP2 MISSION shRNA Bacterial Glycerol Stock
transition protein 2 (during histone to protamine replacement)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013694.4-502s1c1
Sequence:CCGGGCAGCAATTTCTATGCAACATCTCGAGATGTTGCATAGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-319s1c1
Sequence:CCGGGAAGGGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-117s1c1
Sequence:CCGGTCAAAGTCACACCAGTAACCACTCGAGTGGTTACTGGTGTGACTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-357s1c1
Sequence:CCGGGAAACGGACTCACAGAGCTAACTCGAGTTAGCTCTGTGAGTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-307s1c1
Sequence:CCGGAGGAAGACCTTTGAAGGGAAACTCGAGTTTCCCTTCAAAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013694.4-469s21c1
Sequence:CCGGACTGTTGGGATGATGTCACAGCTCGAGCTGTGACATCATCCCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-404s21c1
Sequence:CCGGAGTGACGCACTCCAGGATGTTCTCGAGAACATCCTGGAGTGCGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-256s21c1
Sequence:CCGGTCTCGACACTCACCTGCAAGACTCGAGTCTTGCAGGTGAGTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013694
TNP2 MISSION shRNA shRNA Plasmid DNA
transition protein 2 (during histone to protamine replacement)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013694.4-502s1c1
Sequence:CCGGGCAGCAATTTCTATGCAACATCTCGAGATGTTGCATAGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-319s1c1
Sequence:CCGGGAAGGGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-117s1c1
Sequence:CCGGTCAAAGTCACACCAGTAACCACTCGAGTGGTTACTGGTGTGACTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-357s1c1
Sequence:CCGGGAAACGGACTCACAGAGCTAACTCGAGTTAGCTCTGTGAGTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-307s1c1
Sequence:CCGGAGGAAGACCTTTGAAGGGAAACTCGAGTTTCCCTTCAAAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013694.4-469s21c1
Sequence:CCGGACTGTTGGGATGATGTCACAGCTCGAGCTGTGACATCATCCCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-404s21c1
Sequence:CCGGAGTGACGCACTCCAGGATGTTCTCGAGAACATCCTGGAGTGCGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-256s21c1
Sequence:CCGGTCTCGACACTCACCTGCAAGACTCGAGTCTTGCAGGTGAGTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013694
TNP2 MISSION shRNA Lentiviral Transduction Particles
transition protein 2 (during histone to protamine replacement)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013694.4-502s1c1
Sequence:CCGGGCAGCAATTTCTATGCAACATCTCGAGATGTTGCATAGAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-319s1c1
Sequence:CCGGGAAGGGAAAGTGAGCAAGAGACTCGAGTCTCTTGCTCACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-117s1c1
Sequence:CCGGTCAAAGTCACACCAGTAACCACTCGAGTGGTTACTGGTGTGACTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-357s1c1
Sequence:CCGGGAAACGGACTCACAGAGCTAACTCGAGTTAGCTCTGTGAGTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013694.4-307s1c1
Sequence:CCGGAGGAAGACCTTTGAAGGGAAACTCGAGTTTCCCTTCAAAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013694.4-469s21c1
Sequence:CCGGACTGTTGGGATGATGTCACAGCTCGAGCTGTGACATCATCCCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-404s21c1
Sequence:CCGGAGTGACGCACTCCAGGATGTTCTCGAGAACATCCTGGAGTGCGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013694.4-256s21c1
Sequence:CCGGTCTCGACACTCACCTGCAAGACTCGAGTCTTGCAGGTGAGTGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005425
TNP2 MISSION shRNA Bacterial Glycerol Stock
transition protein 2 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-437s1c1
Sequence:CCGGCTCAGGATGGAAATCCAACTACTCGAGTAGTTGGATTTCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-119s1c1
Sequence:CCGGCACCCGCCATTGCCAAACCTTCTCGAGAAGGTTTGGCAATGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-430s1c1
Sequence:CCGGCGCGGAGCTCAGGATGGAAATCTCGAGATTTCCATCCTGAGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-270s1c1
Sequence:CCGGCCACCACCAAAGCGCCACAAACTCGAGTTTGTGGCGCTTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-356s1c1
Sequence:CCGGCAGAAAGAACTTGGAAGGCAACTCGAGTTGCCTTCCAAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-147s21c1
Sequence:CCGGAGTTGCAGACAGAGCCATCGTCTCGAGACGATGGCTCTGTCTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-295s21c1
Sequence:CCGGCTATGAACTCCCACCACTCTCCTCGAGGAGAGTGGTGGGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005425
TNP2 MISSION shRNA shRNA Plasmid DNA
transition protein 2 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-437s1c1
Sequence:CCGGCTCAGGATGGAAATCCAACTACTCGAGTAGTTGGATTTCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-119s1c1
Sequence:CCGGCACCCGCCATTGCCAAACCTTCTCGAGAAGGTTTGGCAATGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-430s1c1
Sequence:CCGGCGCGGAGCTCAGGATGGAAATCTCGAGATTTCCATCCTGAGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-270s1c1
Sequence:CCGGCCACCACCAAAGCGCCACAAACTCGAGTTTGTGGCGCTTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-356s1c1
Sequence:CCGGCAGAAAGAACTTGGAAGGCAACTCGAGTTGCCTTCCAAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-147s21c1
Sequence:CCGGAGTTGCAGACAGAGCCATCGTCTCGAGACGATGGCTCTGTCTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-295s21c1
Sequence:CCGGCTATGAACTCCCACCACTCTCCTCGAGGAGAGTGGTGGGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005425
TNP2 MISSION shRNA Lentiviral Transduction Particles
transition protein 2 (during histone to protamine replacement)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-437s1c1
Sequence:CCGGCTCAGGATGGAAATCCAACTACTCGAGTAGTTGGATTTCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-119s1c1
Sequence:CCGGCACCCGCCATTGCCAAACCTTCTCGAGAAGGTTTGGCAATGGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-430s1c1
Sequence:CCGGCGCGGAGCTCAGGATGGAAATCTCGAGATTTCCATCCTGAGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-270s1c1
Sequence:CCGGCCACCACCAAAGCGCCACAAACTCGAGTTTGTGGCGCTTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005425.4-356s1c1
Sequence:CCGGCAGAAAGAACTTGGAAGGCAACTCGAGTTGCCTTCCAAGTTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-147s21c1
Sequence:CCGGAGTTGCAGACAGAGCCATCGTCTCGAGACGATGGCTCTGTCTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005425.4-295s21c1
Sequence:CCGGCTATGAACTCCCACCACTCTCCTCGAGGAGAGTGGTGGGAGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks