EMAIL THIS PAGE TO A FRIEND

TNPO1

transportin 1

Synonyms: IPO2 KPNB2 MIP MIP1 TRN
UniProtKB ID: Q92973, B4DVC6, Q92957, Q92975
Gene ID:
Human(3842) Summary: This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Mouse(238799) transportin 1
Rat(309126) transportin 1
cow(767620) transportin 1
sheep(101115311) transportin 1
Zebrafish(562607) transportin 1
Horse(100073294) transportin 1
domestic cat(101096201) transportin 1
dog(478093) transportin 1
chicken(427218) transportin 1
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002270 Rosetta Predictions human pricing
NM_153188 Rosetta Predictions human pricing
XM_001070389 Rosetta Predictions rat pricing
XM_219500 Rosetta Predictions rat pricing
NM_001048267 Rosetta Predictions mouse pricing
NM_178716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130551 predicted 2454
2 SASI_Hs01_00130552 predicted 537
3 SASI_Hs01_00130553 predicted 883
4 SASI_Hs01_00130554 predicted 2399
5 SASI_Hs01_00130555 predicted 2684
6 SASI_Hs02_00333537 predicted 710
7 SASI_Hs01_00130556 predicted 2845
8 SASI_Hs01_00130559 predicted 2266
9 SASI_Hs01_00130560 predicted 2058
10 SASI_Hs02_00333538 predicted 2001
11 SASI_Hs01_00130557 predicted 1402
12 SASI_Hs01_00130558 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237096 predicted 2438
2 SASI_Hs01_00237097 predicted 524
3 SASI_Hs01_00237098 predicted 862
4 SASI_Hs01_00237099 predicted 2386
5 SASI_Hs01_00237100 predicted 2669
6 SASI_Hs02_00367033 predicted 698
7 SASI_Hs01_00237101 predicted 2838
8 SASI_Hs01_00237104 predicted 2253
9 SASI_Hs01_00237105 predicted 2047
10 SASI_Hs02_00367034 predicted 1980
11 SASI_Hs01_00237102 predicted 1381
12 SASI_Hs01_00237103 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331481 predicted 1719
2 SASI_Rn02_00331482 predicted 1106
3 SASI_Rn02_00331483 predicted 1579
4 SASI_Rn02_00331484 predicted 2777
5 SASI_Rn02_00331485 predicted 2639
6 SASI_Rn02_00331486 predicted 3254
7 SASI_Rn02_00331487 predicted 2941
8 SASI_Rn02_00331488 predicted 2625
9 SASI_Rn02_00331489 predicted 3292
10 SASI_Rn02_00331490 predicted 3244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378505 predicted 1118
2 SASI_Rn02_00378506 predicted 507
3 SASI_Rn02_00378507 predicted 982
4 SASI_Rn02_00378508 predicted 2177
5 SASI_Rn02_00378509 predicted 2040
6 SASI_Rn02_00378510 predicted 2659
7 SASI_Rn02_00378511 predicted 2336
8 SASI_Rn02_00378512 predicted 2027
9 SASI_Rn02_00378513 predicted 2686
10 SASI_Rn02_00378514 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292299 predicted 403
2 SASI_Mm02_00292300 predicted 2600
3 SASI_Mm02_00292301 predicted 2128
4 SASI_Mm02_00292302 predicted 1115
5 SASI_Mm02_00292303 predicted 2694
6 SASI_Mm02_00292304 predicted 1579
7 SASI_Mm02_00292305 predicted 2227
8 SASI_Mm02_00292306 predicted 2334
9 SASI_Mm02_00292307 predicted 1285
10 SASI_Mm02_00292308 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159811 predicted 407
2 SASI_Mm01_00159812 predicted 2605
3 SASI_Mm02_00349224 predicted 2656
4 SASI_Mm01_00159813 predicted 2135
5 SASI_Mm02_00349225 predicted 336
6 SASI_Mm01_00159815 predicted 2692
7 SASI_Mm01_00159816 predicted 1583
8 SASI_Mm01_00159817 predicted 2241
9 SASI_Mm01_00159818 predicted 2349
10 SASI_Mm01_00159820 predicted 1957
11 SASI_Mm01_00159814 predicted 1087
12 SASI_Mm01_00159819 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002270
VALIDATED
TNPO1 MISSION shRNA Bacterial Glycerol Stock
transportin 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2049s21c1
Sequence:GTACCGGCAATGCTCAACCAGATCAATACTCGAGTATTGATCTGGTTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2403s21c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-793s21c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-3231s21c1
Sequence:CCGGACAATTCTATAGCGCACAATACTCGAGTATTGTGCGCTATAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2683s21c1
Sequence:GTACCGGGCCGTTGCATCATGGATTAACCTCGAGGTTAATCCATGATGCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2290s21c1
Sequence:GTACCGGGCTGATTTCATGCCAATATTGCTCGAGCAATATTGGCATGAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1597s21c1
Sequence:GTACCGGACGTACCTGAAGCCATTAATGCTCGAGCATTAATGGCTTCAGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1978s21c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2603s21c1
Sequence:GTACCGGATTCAGCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-1097s21c1
Sequence:GTACCGGAGTACTCAGACATAGATATTACTCGAGTAATATCTATGTCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2638s21c1
Sequence:GTACCGGGTGAATCCCAGTGGCGTAATCCTCGAGGATTACGCCACTGGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2533s1c1
Sequence:CCGGCCGTGGAATTTGTACCATGATCTCGAGATCATGGTACAAATTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002270.2-1378s1c1
Sequence:CCGGGCAGGGCATGATTCCATACTTCTCGAGAAGTATGGAATCATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-713s1c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-1898s1c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2323s1c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002270
VALIDATED
TNPO1 MISSION shRNA shRNA Plasmid DNA
transportin 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2049s21c1
Sequence:GTACCGGCAATGCTCAACCAGATCAATACTCGAGTATTGATCTGGTTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2403s21c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-793s21c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-3231s21c1
Sequence:CCGGACAATTCTATAGCGCACAATACTCGAGTATTGTGCGCTATAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2683s21c1
Sequence:GTACCGGGCCGTTGCATCATGGATTAACCTCGAGGTTAATCCATGATGCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2290s21c1
Sequence:GTACCGGGCTGATTTCATGCCAATATTGCTCGAGCAATATTGGCATGAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1597s21c1
Sequence:GTACCGGACGTACCTGAAGCCATTAATGCTCGAGCATTAATGGCTTCAGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1978s21c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2603s21c1
Sequence:GTACCGGATTCAGCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-1097s21c1
Sequence:GTACCGGAGTACTCAGACATAGATATTACTCGAGTAATATCTATGTCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2638s21c1
Sequence:GTACCGGGTGAATCCCAGTGGCGTAATCCTCGAGGATTACGCCACTGGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2533s1c1
Sequence:CCGGCCGTGGAATTTGTACCATGATCTCGAGATCATGGTACAAATTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002270.2-1378s1c1
Sequence:CCGGGCAGGGCATGATTCCATACTTCTCGAGAAGTATGGAATCATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-713s1c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-1898s1c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2323s1c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002270
VALIDATED
TNPO1 MISSION shRNA Lentiviral Transduction Particles
transportin 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2049s21c1
Sequence:GTACCGGCAATGCTCAACCAGATCAATACTCGAGTATTGATCTGGTTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2403s21c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-793s21c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-3231s21c1
Sequence:CCGGACAATTCTATAGCGCACAATACTCGAGTATTGTGCGCTATAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2683s21c1
Sequence:GTACCGGGCCGTTGCATCATGGATTAACCTCGAGGTTAATCCATGATGCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2290s21c1
Sequence:GTACCGGGCTGATTTCATGCCAATATTGCTCGAGCAATATTGGCATGAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1597s21c1
Sequence:GTACCGGACGTACCTGAAGCCATTAATGCTCGAGCATTAATGGCTTCAGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002270.3-1978s21c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2603s21c1
Sequence:GTACCGGATTCAGCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-1097s21c1
Sequence:GTACCGGAGTACTCAGACATAGATATTACTCGAGTAATATCTATGTCTGAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002270.3-2638s21c1
Sequence:GTACCGGGTGAATCCCAGTGGCGTAATCCTCGAGGATTACGCCACTGGGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2533s1c1
Sequence:CCGGCCGTGGAATTTGTACCATGATCTCGAGATCATGGTACAAATTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002270.2-1378s1c1
Sequence:CCGGGCAGGGCATGATTCCATACTTCTCGAGAAGTATGGAATCATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-713s1c1
Sequence:CCGGGCTCTAATGTTGCACATTGATCTCGAGATCAATGTGCAACATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-1898s1c1
Sequence:CCGGCCGTACTGTGAACCTGTGTATCTCGAGATACACAGGTTCACAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002270.2-2323s1c1
Sequence:CCGGGCCTTATATTCCTATGGTGTTCTCGAGAACACCATAGGAATATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178716
VALIDATED
TNPO1 MISSION shRNA Bacterial Glycerol Stock
transportin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1128s21c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-2287s21c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1728s21c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1790s21c1
Sequence:CCGGAGATTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-3114s21c1
Sequence:CCGGCAGTACTTTCTGGAATATTATCTCGAGATAATATTCCAGAAAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178716.2-4507s1c1
Sequence:CCGGCCCATGATGATGAAGGGAAATCTCGAGATTTCCCTTCATCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2545s1c1
Sequence:CCGGCCGTGGGATTTGTACCATGATCTCGAGATCATGGTACAAATCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178716.2-1688s1c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-1088s1c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2247s1c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178716
VALIDATED
TNPO1 MISSION shRNA shRNA Plasmid DNA
transportin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1128s21c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-2287s21c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1728s21c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1790s21c1
Sequence:CCGGAGATTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-3114s21c1
Sequence:CCGGCAGTACTTTCTGGAATATTATCTCGAGATAATATTCCAGAAAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178716.2-4507s1c1
Sequence:CCGGCCCATGATGATGAAGGGAAATCTCGAGATTTCCCTTCATCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2545s1c1
Sequence:CCGGCCGTGGGATTTGTACCATGATCTCGAGATCATGGTACAAATCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178716.2-1688s1c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-1088s1c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2247s1c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178716
VALIDATED
TNPO1 MISSION shRNA Lentiviral Transduction Particles
transportin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1128s21c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-2287s21c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1728s21c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-1790s21c1
Sequence:CCGGAGATTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178716.3-3114s21c1
Sequence:CCGGCAGTACTTTCTGGAATATTATCTCGAGATAATATTCCAGAAAGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178716.2-4507s1c1
Sequence:CCGGCCCATGATGATGAAGGGAAATCTCGAGATTTCCCTTCATCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2545s1c1
Sequence:CCGGCCGTGGGATTTGTACCATGATCTCGAGATCATGGTACAAATCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178716.2-1688s1c1
Sequence:CCGGGCCTTCAGTAAATACCAGCATCTCGAGATGCTGGTATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-1088s1c1
Sequence:CCGGCCGGATAGTGAGCAGGATATACTCGAGTATATCCTGCTCACTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178716.2-2247s1c1
Sequence:CCGGCCAATCTAAATCCAGAGTTTACTCGAGTAAACTCTGGATTTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks