EMAIL THIS PAGE TO A FRIEND

TNPO2

transportin 2

Synonyms: IPO3 KPNB2B TRN2
UniProtKB ID: O14787, O14655, Q6IN77
Gene ID:
Mouse(212999) transportin 2 (importin 3, karyopherin beta 2b)
Rat(304670) transportin 2
Zebrafish(445499) transportin 2 (importin 3, karyopherin beta 2b)
domestic cat(101084858) transportin 2
Horse(100063482) transportin 2
dog(484930) transportin 2
cow(504589) transportin 2
sheep(101106521) transportin 2
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013433 Rosetta Predictions human pricing
NM_001107166 Rosetta Predictions rat pricing
NM_001122843 Rosetta Predictions mouse pricing
NM_145390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028245 predicted 237
2 SASI_Hs01_00028246 predicted 537
3 SASI_Hs02_00344822 predicted 269
4 SASI_Hs01_00028248 predicted 1852
5 SASI_Hs01_00028249 predicted 2127
6 SASI_Hs01_00028250 predicted 415
7 SASI_Hs01_00028251 predicted 2021
8 SASI_Hs01_00028252 predicted 775
9 SASI_Hs01_00028253 predicted 1686
10 SASI_Hs02_00344823 predicted 2508
11 SASI_Hs01_00028247 predicted 406
12 SASI_Hs01_00028254 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226155 predicted 1452
2 SASI_Rn02_00226156 predicted 2095
3 SASI_Rn02_00226157 predicted 206
4 SASI_Rn02_00226158 predicted 2571
5 SASI_Rn02_00226159 predicted 2085
6 SASI_Rn02_00226160 predicted 229
7 SASI_Rn02_00226161 predicted 2351
8 SASI_Rn02_00226162 predicted 2791
9 SASI_Rn02_00226163 predicted 381
10 SASI_Rn02_00226164 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309489 predicted 2266
2 SASI_Mm02_00309490 predicted 2115
3 SASI_Mm02_00309491 predicted 393
4 SASI_Mm02_00309492 predicted 2126
5 SASI_Mm02_00309493 predicted 2281
6 SASI_Mm02_00309494 predicted 2882
7 SASI_Mm02_00309495 predicted 414
8 SASI_Mm02_00309496 predicted 1028
9 SASI_Mm02_00309497 predicted 1477
10 SASI_Mm02_00309498 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340709 predicted 2248
2 SASI_Mm02_00340710 predicted 2103
3 SASI_Mm02_00340711 predicted 373
4 SASI_Mm02_00340712 predicted 2113
5 SASI_Mm02_00340713 predicted 2266
6 SASI_Mm02_00340714 predicted 2867
7 SASI_Mm02_00340715 predicted 389
8 SASI_Mm02_00340716 predicted 1008
9 SASI_Mm02_00340717 predicted 1457
10 SASI_Mm02_00340718 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145390
VALIDATED
TNPO2 MISSION shRNA Bacterial Glycerol Stock
transportin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145390.1-2740s1c1
Sequence:CCGGGAACGTGGAGACCACCAGGTTCTCGAGAACCTGGTGGTCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-2671s1c1
Sequence:CCGGGCAACAGTTCTCAGAGCAGTTCTCGAGAACTGCTCTGAGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-829s1c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1396s1c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1650s1c1
Sequence:CCGGCCTTTGGCAAATACCAGCATACTCGAGTATGCTGGTATTTGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-2919s21c1
Sequence:CCGGAGGAGTCAGTGGGACCTAAATCTCGAGATTTAGGTCCCACTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1012s21c1
Sequence:CCGGTGATCCCTATCCTCGTGAATGCTCGAGCATTCACGAGGATAGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-521s21c1
Sequence:CCGGGCTCAACTCAGAGGATTATAACTCGAGTTATAATCCTCTGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-875s21c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1442s21c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145390
VALIDATED
TNPO2 MISSION shRNA shRNA Plasmid DNA
transportin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145390.1-2740s1c1
Sequence:CCGGGAACGTGGAGACCACCAGGTTCTCGAGAACCTGGTGGTCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-2671s1c1
Sequence:CCGGGCAACAGTTCTCAGAGCAGTTCTCGAGAACTGCTCTGAGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-829s1c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1396s1c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1650s1c1
Sequence:CCGGCCTTTGGCAAATACCAGCATACTCGAGTATGCTGGTATTTGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-2919s21c1
Sequence:CCGGAGGAGTCAGTGGGACCTAAATCTCGAGATTTAGGTCCCACTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1012s21c1
Sequence:CCGGTGATCCCTATCCTCGTGAATGCTCGAGCATTCACGAGGATAGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-521s21c1
Sequence:CCGGGCTCAACTCAGAGGATTATAACTCGAGTTATAATCCTCTGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-875s21c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1442s21c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145390
VALIDATED
TNPO2 MISSION shRNA Lentiviral Transduction Particles
transportin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145390.1-2740s1c1
Sequence:CCGGGAACGTGGAGACCACCAGGTTCTCGAGAACCTGGTGGTCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-2671s1c1
Sequence:CCGGGCAACAGTTCTCAGAGCAGTTCTCGAGAACTGCTCTGAGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-829s1c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1396s1c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145390.1-1650s1c1
Sequence:CCGGCCTTTGGCAAATACCAGCATACTCGAGTATGCTGGTATTTGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-2919s21c1
Sequence:CCGGAGGAGTCAGTGGGACCTAAATCTCGAGATTTAGGTCCCACTGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1012s21c1
Sequence:CCGGTGATCCCTATCCTCGTGAATGCTCGAGCATTCACGAGGATAGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-521s21c1
Sequence:CCGGGCTCAACTCAGAGGATTATAACTCGAGTTATAATCCTCTGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-875s21c1
Sequence:CCGGGCACAGCATCATCCAGTACATCTCGAGATGTACTGGATGATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145390.4-1442s21c1
Sequence:CCGGCCAGTGCCTGTCAGATAAGAACTCGAGTTCTTATCTGACAGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013433
VALIDATED
TNPO2 MISSION shRNA Bacterial Glycerol Stock
transportin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-690s1c1
Sequence:CCGGCCTGCTTAACTCGGAGGATTACTCGAGTAATCCTCCGAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-1857s1c1
Sequence:CCGGCCTTGTCTTTGCCTTTGGGAACTCGAGTTCCCAAAGGCAAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2188s1c1
Sequence:CCGGCCCGACAAGGACTTTATGATACTCGAGTATCATAAAGTCCTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013433.2-541s1c1
Sequence:CCGGCCTGTGGCAGACTTCATCAAACTCGAGTTTGATGAAGTCTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2468s1c1
Sequence:CCGGCCTGGGCCATTGGTGAAATTTCTCGAGAAATTTCACCAATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1491s21c1
Sequence:CCGGGATCCAGTGCCTGTCGGATAACTCGAGTTATCCGACAGGCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1084s21c1
Sequence:CCGGGGGATGAAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013433.4-2942s21c1
Sequence:CCGGAGGAGTGAGTGGGACTCAAATCTCGAGATTTGAGTCCCACTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-2641s21c1
Sequence:CCGGGGCGTTGTGCAGGACTTTATTCTCGAGAATAAAGTCCTGCACAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1266s21c1
Sequence:CCGGTGCTCTGTCCGACTGGAATTTCTCGAGAAATTCCAGTCGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013433
VALIDATED
TNPO2 MISSION shRNA shRNA Plasmid DNA
transportin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-690s1c1
Sequence:CCGGCCTGCTTAACTCGGAGGATTACTCGAGTAATCCTCCGAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-1857s1c1
Sequence:CCGGCCTTGTCTTTGCCTTTGGGAACTCGAGTTCCCAAAGGCAAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2188s1c1
Sequence:CCGGCCCGACAAGGACTTTATGATACTCGAGTATCATAAAGTCCTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013433.2-541s1c1
Sequence:CCGGCCTGTGGCAGACTTCATCAAACTCGAGTTTGATGAAGTCTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2468s1c1
Sequence:CCGGCCTGGGCCATTGGTGAAATTTCTCGAGAAATTTCACCAATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1491s21c1
Sequence:CCGGGATCCAGTGCCTGTCGGATAACTCGAGTTATCCGACAGGCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1084s21c1
Sequence:CCGGGGGATGAAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013433.4-2942s21c1
Sequence:CCGGAGGAGTGAGTGGGACTCAAATCTCGAGATTTGAGTCCCACTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-2641s21c1
Sequence:CCGGGGCGTTGTGCAGGACTTTATTCTCGAGAATAAAGTCCTGCACAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1266s21c1
Sequence:CCGGTGCTCTGTCCGACTGGAATTTCTCGAGAAATTCCAGTCGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013433
VALIDATED
TNPO2 MISSION shRNA Lentiviral Transduction Particles
transportin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-690s1c1
Sequence:CCGGCCTGCTTAACTCGGAGGATTACTCGAGTAATCCTCCGAGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-1857s1c1
Sequence:CCGGCCTTGTCTTTGCCTTTGGGAACTCGAGTTCCCAAAGGCAAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2188s1c1
Sequence:CCGGCCCGACAAGGACTTTATGATACTCGAGTATCATAAAGTCCTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013433.2-541s1c1
Sequence:CCGGCCTGTGGCAGACTTCATCAAACTCGAGTTTGATGAAGTCTGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013433.2-2468s1c1
Sequence:CCGGCCTGGGCCATTGGTGAAATTTCTCGAGAAATTTCACCAATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1491s21c1
Sequence:CCGGGATCCAGTGCCTGTCGGATAACTCGAGTTATCCGACAGGCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1084s21c1
Sequence:CCGGGGGATGAAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013433.4-2942s21c1
Sequence:CCGGAGGAGTGAGTGGGACTCAAATCTCGAGATTTGAGTCCCACTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-2641s21c1
Sequence:CCGGGGCGTTGTGCAGGACTTTATTCTCGAGAATAAAGTCCTGCACAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013433.4-1266s21c1
Sequence:CCGGTGCTCTGTCCGACTGGAATTTCTCGAGAAATTCCAGTCGGACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks