EMAIL THIS PAGE TO A FRIEND

TNPO3

transportin 3

Synonyms: IPO12 MTR10A TRN-SR TRN-SR2 TRNSR
Gene ID:
Human(23534) Summary: The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
Mouse(320938) transportin 3
Rat(296954) transportin 3
cow(537183) transportin 3
sheep(101113231) transportin 3
Zebrafish(394062) transportin 3
chicken(426277) transportin 3
domestic cat(101082893) transportin 3
dog(482263) transportin 3
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012470 Rosetta Predictions human pricing
NM_001106587 Rosetta Predictions rat pricing
NM_177296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173136 predicted 1245
2 SASI_Hs02_00344383 predicted 2215
3 SASI_Hs01_00173137 predicted 834
4 SASI_Hs01_00173138 predicted 633
5 SASI_Hs01_00173139 predicted 505
6 SASI_Hs01_00173141 predicted 2565
7 SASI_Hs01_00173142 predicted 2822
8 SASI_Hs01_00173143 predicted 1711
9 SASI_Hs01_00173144 predicted 3073
10 SASI_Hs01_00173145 predicted 386
11 SASI_Hs01_00173140 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220418 predicted 2383
2 SASI_Rn02_00220419 predicted 946
3 SASI_Rn02_00220420 predicted 1851
4 SASI_Rn02_00220421 predicted 1228
5 SASI_Rn02_00220422 predicted 2442
6 SASI_Rn02_00220423 predicted 1683
7 SASI_Rn02_00220424 predicted 2192
8 SASI_Rn02_00220425 predicted 1916
9 SASI_Rn02_00220426 predicted 1000
10 SASI_Rn02_00220427 predicted 2806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157484 predicted 2577
2 SASI_Mm01_00157485 predicted 723
3 SASI_Mm01_00157487 predicted 1627
4 SASI_Mm01_00157489 predicted 762
5 SASI_Mm01_00157490 predicted 1689
6 SASI_Mm02_00347372 predicted 1184
7 SASI_Mm02_00347373 predicted 251
8 SASI_Mm01_00157491 predicted 2558
9 SASI_Mm01_00157493 predicted 1087
10 SASI_Mm02_00347374 predicted 1832
11 SASI_Mm01_00157486 predicted 1464
12 SASI_Mm01_00157488 predicted 2845
13 SASI_Mm01_00157492 predicted 2310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012470
VALIDATED
TNPO3 MISSION shRNA Bacterial Glycerol Stock
transportin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012470.2-2084s21c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-3217s21c1
Sequence:CCGGACCAGACTGTGTCCCACAATCCTCGAGGATTGTGGGACACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-867s21c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-1374s21c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012470.2-2697s1c1
Sequence:CCGGCCTATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-867s1c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2084s1c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2331s1c1
Sequence:CCGGCGAGCTGATAATCGGATTGTACTCGAGTACAATCCGATTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-1374s1c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012470
VALIDATED
TNPO3 MISSION shRNA shRNA Plasmid DNA
transportin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012470.2-2084s21c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-3217s21c1
Sequence:CCGGACCAGACTGTGTCCCACAATCCTCGAGGATTGTGGGACACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-867s21c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-1374s21c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012470.2-2697s1c1
Sequence:CCGGCCTATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-867s1c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2084s1c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2331s1c1
Sequence:CCGGCGAGCTGATAATCGGATTGTACTCGAGTACAATCCGATTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-1374s1c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012470
VALIDATED
TNPO3 MISSION shRNA Lentiviral Transduction Particles
transportin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012470.2-2084s21c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-3217s21c1
Sequence:CCGGACCAGACTGTGTCCCACAATCCTCGAGGATTGTGGGACACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-867s21c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012470.2-1374s21c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012470.2-2697s1c1
Sequence:CCGGCCTATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-867s1c1
Sequence:CCGGCGGCGCACAGAAATTATAGAACTCGAGTTCTATAATTTCTGTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2084s1c1
Sequence:CCGGCCGATTACCTTTGGATAAGATCTCGAGATCTTATCCAAAGGTAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-2331s1c1
Sequence:CCGGCGAGCTGATAATCGGATTGTACTCGAGTACAATCCGATTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012470.2-1374s1c1
Sequence:CCGGCCTCAATATGAGGTAGTAGAACTCGAGTTCTACTACCTCATATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177296
TNPO3 MISSION shRNA Bacterial Glycerol Stock
transportin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177296.3-3167s1c1
Sequence:CCGGCCTGGTGAACTTCTTTCTAAACTCGAGTTTAGAAAGAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-2445s1c1
Sequence:CCGGCCAATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-574s1c1
Sequence:CCGGCCGAAGAAGTACATAGTCGTTCTCGAGAACGACTATGTACTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-1122s1c1
Sequence:CCGGCCTCAGTATGAGGTAGTAGAACTCGAGTTCTACTACCTCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-496s1c1
Sequence:CCGGGCGTACAAACATTGGTAGAAACTCGAGTTTCTACCAATGTTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177296
TNPO3 MISSION shRNA shRNA Plasmid DNA
transportin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177296.3-3167s1c1
Sequence:CCGGCCTGGTGAACTTCTTTCTAAACTCGAGTTTAGAAAGAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-2445s1c1
Sequence:CCGGCCAATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-574s1c1
Sequence:CCGGCCGAAGAAGTACATAGTCGTTCTCGAGAACGACTATGTACTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-1122s1c1
Sequence:CCGGCCTCAGTATGAGGTAGTAGAACTCGAGTTCTACTACCTCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-496s1c1
Sequence:CCGGGCGTACAAACATTGGTAGAAACTCGAGTTTCTACCAATGTTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177296
TNPO3 MISSION shRNA Lentiviral Transduction Particles
transportin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177296.3-3167s1c1
Sequence:CCGGCCTGGTGAACTTCTTTCTAAACTCGAGTTTAGAAAGAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-2445s1c1
Sequence:CCGGCCAATCTTACAGTGGGCCATTCTCGAGAATGGCCCACTGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-574s1c1
Sequence:CCGGCCGAAGAAGTACATAGTCGTTCTCGAGAACGACTATGTACTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-1122s1c1
Sequence:CCGGCCTCAGTATGAGGTAGTAGAACTCGAGTTCTACTACCTCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177296.3-496s1c1
Sequence:CCGGGCGTACAAACATTGGTAGAAACTCGAGTTTCTACCAATGTTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks