EMAIL THIS PAGE TO A FRIEND

TNR

tenascin R

Synonyms: TN-R
UniProtKB ID: Q92752, C9J563, Q15568, Q5R3G0
Gene ID:
Human(7143) Summary: Tenascin-R (TNR) is an extracellular matix protein expressed primarily in the central nervous system. It is a member of the tenascin (TN) gene family, which includes at least 3 genes in mammals: TNC (or hexabrachion; MIM 187380), TNX (TNXB; MIM 600985), and TNR (Erickson, 1993 [PubMed 7694605]
Mouse(21960) tenascin R
Rat(25567) tenascin R
Zebrafish(369191) tenascin R (restrictin, janusin)
Horse(100061691) tenascin R
dog(490334) tenascin R
chicken(396213) tenascin R (restrictin, janusin)
cow(526409) tenascin R (restrictin, janusin)
sheep(101117435) tenascin R
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003285 Rosetta Predictions human pricing
NM_013045 Rosetta Predictions rat pricing
NM_022312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177489 predicted 4405
2 SASI_Hs01_00177490 predicted 2792
3 SASI_Hs01_00177491 predicted 4387
4 SASI_Hs01_00177492 predicted 1999
5 SASI_Hs01_00177493 predicted 2538
6 SASI_Hs01_00177494 predicted 4612
7 SASI_Hs01_00177495 predicted 2390
8 SASI_Hs01_00177497 predicted 2684
9 SASI_Hs01_00177498 predicted 4136
10 SASI_Hs02_00335353 predicted 4127
11 SASI_Hs01_00177496 predicted 3753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074546 predicted 2139
2 SASI_Rn01_00074547 predicted 3729
3 SASI_Rn01_00074548 predicted 3756
4 SASI_Rn01_00074549 predicted 2279
5 SASI_Rn02_00260770 predicted 3643
6 SASI_Rn01_00074551 predicted 2152
7 SASI_Rn02_00260771 predicted 1593
8 SASI_Rn01_00074552 predicted 2911
9 SASI_Rn01_00074554 predicted 2765
10 SASI_Rn01_00074555 predicted 2477
11 SASI_Rn01_00074550 predicted 440
12 SASI_Rn01_00074553 predicted 3995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073136 predicted 2385
2 SASI_Mm01_00073137 predicted 2814
3 SASI_Mm01_00073138 predicted 3617
4 SASI_Mm01_00073139 predicted 4211
5 SASI_Mm02_00326532 predicted 2681
6 SASI_Mm01_00073140 predicted 885
7 SASI_Mm01_00073141 predicted 4442
8 SASI_Mm02_00326533 predicted 2343
9 SASI_Mm02_00326534 predicted 4100
10 SASI_Mm01_00073143 predicted 2930
11 SASI_Mm01_00073142 predicted 3219
12 SASI_Mm01_00073144 predicted 4276
13 SASI_Mm01_00073145 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022312
TNR MISSION shRNA Bacterial Glycerol Stock
tenascin R
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022312.1-4783s1c1
Sequence:CCGGCTTCACAACATATTCAGACTACTCGAGTAGTCTGAATATGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2195s1c1
Sequence:CCGGGCCAAAGTTGATTTCATTCTTCTCGAGAAGAATGAAATCAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2349s1c1
Sequence:CCGGCCAATGAGAGTGAAGCCTCAACTCGAGTTGAGGCTTCACTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2400s1c1
Sequence:CCGGCCAAGAATTTGCGAGTGGGTTCTCGAGAACCCACTCGCAAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-4193s1c1
Sequence:CCGGGCAGATTATCGTGTTGGCTTTCTCGAGAAAGCCAACACGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022312
TNR MISSION shRNA shRNA Plasmid DNA
tenascin R
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022312.1-4783s1c1
Sequence:CCGGCTTCACAACATATTCAGACTACTCGAGTAGTCTGAATATGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2195s1c1
Sequence:CCGGGCCAAAGTTGATTTCATTCTTCTCGAGAAGAATGAAATCAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2349s1c1
Sequence:CCGGCCAATGAGAGTGAAGCCTCAACTCGAGTTGAGGCTTCACTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2400s1c1
Sequence:CCGGCCAAGAATTTGCGAGTGGGTTCTCGAGAACCCACTCGCAAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-4193s1c1
Sequence:CCGGGCAGATTATCGTGTTGGCTTTCTCGAGAAAGCCAACACGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022312
TNR MISSION shRNA Lentiviral Transduction Particles
tenascin R
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022312.1-4783s1c1
Sequence:CCGGCTTCACAACATATTCAGACTACTCGAGTAGTCTGAATATGTTGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2195s1c1
Sequence:CCGGGCCAAAGTTGATTTCATTCTTCTCGAGAAGAATGAAATCAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2349s1c1
Sequence:CCGGCCAATGAGAGTGAAGCCTCAACTCGAGTTGAGGCTTCACTCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-2400s1c1
Sequence:CCGGCCAAGAATTTGCGAGTGGGTTCTCGAGAACCCACTCGCAAATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022312.1-4193s1c1
Sequence:CCGGGCAGATTATCGTGTTGGCTTTCTCGAGAAAGCCAACACGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003285
TNR MISSION shRNA Bacterial Glycerol Stock
tenascin R
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-1469s1c1
Sequence:CCGGCCAGCGATGTTACGTCCTTTACTCGAGTAAAGGACGTAACATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3563s1c1
Sequence:CCGGGCCAGAAATTACAAGTGTACTCTCGAGAGTACACTTGTAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3022s1c1
Sequence:CCGGGAGAACTACGTCATTGTTCTTCTCGAGAAGAACAATGACGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-2084s1c1
Sequence:CCGGCCGTCATGAACTCACAGCAAACTCGAGTTTGCTGTGAGTTCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-3561s1c1
Sequence:CCGGGAGCCAGAAATTACAAGTGTACTCGAGTACACTTGTAATTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4230s1c1
Sequence:CCGGGAGGGTAATAGCAATGTGTTTCTCGAGAAACACATTGCTATTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4521s1c1
Sequence:CCGGCCTTCCAGGTATTTGTGATTTCTCGAGAAATCACAAATACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003285.2-4643s21c1
Sequence:CCGGGCTGCAAGCCAACCAATATTTCTCGAGAAATATTGGTTGGCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-3229s21c1
Sequence:CCGGGATTACTACCGAGTATCATATCTCGAGATATGATACTCGGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-1600s21c1
Sequence:CCGGCCGATGGCAGTGACGGAATATCTCGAGATATTCCGTCACTGCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003285
TNR MISSION shRNA shRNA Plasmid DNA
tenascin R
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-1469s1c1
Sequence:CCGGCCAGCGATGTTACGTCCTTTACTCGAGTAAAGGACGTAACATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3563s1c1
Sequence:CCGGGCCAGAAATTACAAGTGTACTCTCGAGAGTACACTTGTAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3022s1c1
Sequence:CCGGGAGAACTACGTCATTGTTCTTCTCGAGAAGAACAATGACGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-2084s1c1
Sequence:CCGGCCGTCATGAACTCACAGCAAACTCGAGTTTGCTGTGAGTTCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-3561s1c1
Sequence:CCGGGAGCCAGAAATTACAAGTGTACTCGAGTACACTTGTAATTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4230s1c1
Sequence:CCGGGAGGGTAATAGCAATGTGTTTCTCGAGAAACACATTGCTATTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4521s1c1
Sequence:CCGGCCTTCCAGGTATTTGTGATTTCTCGAGAAATCACAAATACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003285.2-4643s21c1
Sequence:CCGGGCTGCAAGCCAACCAATATTTCTCGAGAAATATTGGTTGGCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-3229s21c1
Sequence:CCGGGATTACTACCGAGTATCATATCTCGAGATATGATACTCGGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-1600s21c1
Sequence:CCGGCCGATGGCAGTGACGGAATATCTCGAGATATTCCGTCACTGCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003285
TNR MISSION shRNA Lentiviral Transduction Particles
tenascin R
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-1469s1c1
Sequence:CCGGCCAGCGATGTTACGTCCTTTACTCGAGTAAAGGACGTAACATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3563s1c1
Sequence:CCGGGCCAGAAATTACAAGTGTACTCTCGAGAGTACACTTGTAATTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003285.1-3022s1c1
Sequence:CCGGGAGAACTACGTCATTGTTCTTCTCGAGAAGAACAATGACGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-2084s1c1
Sequence:CCGGCCGTCATGAACTCACAGCAAACTCGAGTTTGCTGTGAGTTCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003285.1-3561s1c1
Sequence:CCGGGAGCCAGAAATTACAAGTGTACTCGAGTACACTTGTAATTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4230s1c1
Sequence:CCGGGAGGGTAATAGCAATGTGTTTCTCGAGAAACACATTGCTATTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003285.1-4521s1c1
Sequence:CCGGCCTTCCAGGTATTTGTGATTTCTCGAGAAATCACAAATACCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003285.2-4643s21c1
Sequence:CCGGGCTGCAAGCCAACCAATATTTCTCGAGAAATATTGGTTGGCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-3229s21c1
Sequence:CCGGGATTACTACCGAGTATCATATCTCGAGATATGATACTCGGTAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003285.2-1600s21c1
Sequence:CCGGCCGATGGCAGTGACGGAATATCTCGAGATATTCCGTCACTGCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks