EMAIL THIS PAGE TO A FRIEND

TNRC18

trinucleotide repeat containing 18

Synonyms: CAGL79 TNRC18A
UniProtKB ID: O15417, A8MX41, Q96JH1, Q96K91
Gene ID:
Mouse(231861) trinucleotide repeat containing 18
Rat(304302) trinucleotide repeat containing 18
chicken(416482) trinucleotide repeat containing 18
dog(489882) trinucleotide repeat containing 18
domestic cat(101095785) trinucleotide repeat containing 18
domestic guinea pig(100733130) trinucleotide repeat containing 18
naked mole-rat(101719895) trinucleotide repeat containing 18
cow(526616) trinucleotide repeat containing 18
sheep(101108714) trinucleotide repeat containing 18
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080495 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080495 Rosetta Predictions human pricing
XM_376567 Rosetta Predictions human pricing
NM_001107123 Rosetta Predictions rat pricing
NM_001122730 Rosetta Predictions mouse pricing
NM_178242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315395 predicted 5166
2 SASI_Hs02_00315396 predicted 6699
3 SASI_Hs02_00315397 predicted 489
4 SASI_Hs02_00315398 predicted 9038
5 SASI_Hs02_00315399 predicted 5095
6 SASI_Hs02_00315400 predicted 2933
7 SASI_Hs02_00315401 predicted 4218
8 SASI_Hs02_00315402 predicted 2101
9 SASI_Hs02_00315403 predicted 2944
10 SASI_Hs02_00315404 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284851 predicted 4702
2 SASI_Hs01_00284852 predicted 4843
3 SASI_Hs01_00284853 predicted 4569
4 SASI_Hs01_00284854 predicted 4673
5 SASI_Hs01_00284855 predicted 1555
6 SASI_Hs01_00284856 predicted 4295
7 SASI_Hs01_00284857 predicted 4714
8 SASI_Hs01_00284858 predicted 2313
9 SASI_Hs01_00284859 predicted 4621
10 SASI_Hs01_00284860 predicted 4403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225726 predicted 1899
2 SASI_Rn02_00225727 predicted 2538
3 SASI_Rn02_00225728 predicted 2281
4 SASI_Rn02_00225729 predicted 2171
5 SASI_Rn02_00225730 predicted 2950
6 SASI_Rn02_00225731 predicted 5231
7 SASI_Rn02_00225732 predicted 8933
8 SASI_Rn02_00225733 predicted 5609
9 SASI_Rn02_00225734 predicted 4805
10 SASI_Rn02_00225735 predicted 4971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309254 predicted 2376
2 SASI_Mm02_00309255 predicted 5179
3 SASI_Mm02_00309256 predicted 2305
4 SASI_Mm02_00309257 predicted 3818
5 SASI_Mm02_00309258 predicted 5206
6 SASI_Mm02_00309259 predicted 571
7 SASI_Mm02_00309260 predicted 5156
8 SASI_Mm02_00309261 predicted 2669
9 SASI_Mm02_00309262 predicted 1694
10 SASI_Mm02_00309263 predicted 2564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348636 predicted 2382
2 SASI_Mm01_00146854 predicted 5307
3 SASI_Mm01_00146855 predicted 2304
4 SASI_Mm01_00146856 predicted 3816
5 SASI_Mm01_00146859 predicted 5326
6 SASI_Mm01_00146860 predicted 575
7 SASI_Mm02_00348637 predicted 5291
8 SASI_Mm02_00348638 predicted 2670
9 SASI_Mm02_00348639 predicted 1693
10 SASI_Mm02_00348640 predicted 2561
11 SASI_Mm01_00146852 predicted 4495
12 SASI_Mm01_00146853 predicted 1668
13 SASI_Mm01_00146857 predicted 1900
14 SASI_Mm01_00146858 predicted 4474
15 SASI_Mm01_00146861 predicted 3790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178242
VALIDATED
TNRC18 MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 18
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4950s21c1
Sequence:CCGGTCACGACTCCTCATCTGATTTCTCGAGAAATCAGATGAGGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178242.2-5770s21c1
Sequence:CCGGCCTGCCCTATCCGCCTATATTCTCGAGAATATAGGCGGATAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4538s21c1
Sequence:CCGGAGCGGATGTTTGCTATGAAATCTCGAGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-3823s21c1
Sequence:CCGGCAGATAGAACTACCGAGTAAGCTCGAGCTTACTCGGTAGTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4539s1c1
Sequence:CCGGGCGGATGTTTGCTATGAAATCCTCGAGGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178242.2-4826s21c1
Sequence:CCGGTGCTGACATCAGACGACTATGCTCGAGCATAGTCGTCTGATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178242.2-5855s1c1
Sequence:CCGGGAGCTCTTACACGGACTTGTTCTCGAGAACAAGTCCGTGTAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4487s1c1
Sequence:CCGGCGCGTGAACTGAACTCCAATACTCGAGTATTGGAGTTCAGTTCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-510s1c1
Sequence:CCGGGAAATACATGGCCGGTCTCAACTCGAGTTGAGACCGGCCATGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-3352s1c1
Sequence:CCGGCAGGCCCTGTTCACAGATATTCTCGAGAATATCTGTGAACAGGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178242.2-5359s1c1
Sequence:CCGGGACGAAGACTTCCTGAAGAATCTCGAGATTCTTCAGGAAGTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-4488s1c1
Sequence:CCGGGCGTGAACTGAACTCCAATAACTCGAGTTATTGGAGTTCAGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-1997s1c1
Sequence:CCGGGCACCATGAAACCTGAACCTACTCGAGTAGGTTCAGGTTTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178242
VALIDATED
TNRC18 MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 18
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4950s21c1
Sequence:CCGGTCACGACTCCTCATCTGATTTCTCGAGAAATCAGATGAGGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178242.2-5770s21c1
Sequence:CCGGCCTGCCCTATCCGCCTATATTCTCGAGAATATAGGCGGATAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4538s21c1
Sequence:CCGGAGCGGATGTTTGCTATGAAATCTCGAGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-3823s21c1
Sequence:CCGGCAGATAGAACTACCGAGTAAGCTCGAGCTTACTCGGTAGTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4539s1c1
Sequence:CCGGGCGGATGTTTGCTATGAAATCCTCGAGGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178242.2-4826s21c1
Sequence:CCGGTGCTGACATCAGACGACTATGCTCGAGCATAGTCGTCTGATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178242.2-5855s1c1
Sequence:CCGGGAGCTCTTACACGGACTTGTTCTCGAGAACAAGTCCGTGTAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4487s1c1
Sequence:CCGGCGCGTGAACTGAACTCCAATACTCGAGTATTGGAGTTCAGTTCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-510s1c1
Sequence:CCGGGAAATACATGGCCGGTCTCAACTCGAGTTGAGACCGGCCATGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-3352s1c1
Sequence:CCGGCAGGCCCTGTTCACAGATATTCTCGAGAATATCTGTGAACAGGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178242.2-5359s1c1
Sequence:CCGGGACGAAGACTTCCTGAAGAATCTCGAGATTCTTCAGGAAGTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-4488s1c1
Sequence:CCGGGCGTGAACTGAACTCCAATAACTCGAGTTATTGGAGTTCAGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-1997s1c1
Sequence:CCGGGCACCATGAAACCTGAACCTACTCGAGTAGGTTCAGGTTTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178242
VALIDATED
TNRC18 MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 18
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4950s21c1
Sequence:CCGGTCACGACTCCTCATCTGATTTCTCGAGAAATCAGATGAGGAGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178242.2-5770s21c1
Sequence:CCGGCCTGCCCTATCCGCCTATATTCTCGAGAATATAGGCGGATAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-4538s21c1
Sequence:CCGGAGCGGATGTTTGCTATGAAATCTCGAGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178242.2-3823s21c1
Sequence:CCGGCAGATAGAACTACCGAGTAAGCTCGAGCTTACTCGGTAGTTCTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4539s1c1
Sequence:CCGGGCGGATGTTTGCTATGAAATCCTCGAGGATTTCATAGCAAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178242.2-4826s21c1
Sequence:CCGGTGCTGACATCAGACGACTATGCTCGAGCATAGTCGTCTGATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178242.2-5855s1c1
Sequence:CCGGGAGCTCTTACACGGACTTGTTCTCGAGAACAAGTCCGTGTAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-4487s1c1
Sequence:CCGGCGCGTGAACTGAACTCCAATACTCGAGTATTGGAGTTCAGTTCACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-510s1c1
Sequence:CCGGGAAATACATGGCCGGTCTCAACTCGAGTTGAGACCGGCCATGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178242.2-3352s1c1
Sequence:CCGGCAGGCCCTGTTCACAGATATTCTCGAGAATATCTGTGAACAGGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178242.2-5359s1c1
Sequence:CCGGGACGAAGACTTCCTGAAGAATCTCGAGATTCTTCAGGAAGTCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-4488s1c1
Sequence:CCGGGCGTGAACTGAACTCCAATAACTCGAGTTATTGGAGTTCAGTTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178242.2-1997s1c1
Sequence:CCGGGCACCATGAAACCTGAACCTACTCGAGTAGGTTCAGGTTTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080495
VALIDATED
TNRC18 MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-4731s21c1
Sequence:CCGGAGAAGGAGGAGCGGATGTATGCTCGAGCATACATCCGCTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-5168s21c1
Sequence:CCGGGACTTCATCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2096s21c1
Sequence:CCGGTCGGCCATGCAGAGCCTTATACTCGAGTATAAGGCTCTGCATGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-10159s21c1
Sequence:CCGGCTGACGTGCAGAATATTATTTCTCGAGAAATAATATTCTGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2481s21c1
Sequence:CCGGTGTCGCTGAGTAACGTCAAAGCTCGAGCTTTGACGTTACTCAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080495
VALIDATED
TNRC18 MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-4731s21c1
Sequence:CCGGAGAAGGAGGAGCGGATGTATGCTCGAGCATACATCCGCTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-5168s21c1
Sequence:CCGGGACTTCATCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2096s21c1
Sequence:CCGGTCGGCCATGCAGAGCCTTATACTCGAGTATAAGGCTCTGCATGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-10159s21c1
Sequence:CCGGCTGACGTGCAGAATATTATTTCTCGAGAAATAATATTCTGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2481s21c1
Sequence:CCGGTGTCGCTGAGTAACGTCAAAGCTCGAGCTTTGACGTTACTCAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080495
VALIDATED
TNRC18 MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-4731s21c1
Sequence:CCGGAGAAGGAGGAGCGGATGTATGCTCGAGCATACATCCGCTCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-5168s21c1
Sequence:CCGGGACTTCATCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGATGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2096s21c1
Sequence:CCGGTCGGCCATGCAGAGCCTTATACTCGAGTATAAGGCTCTGCATGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-10159s21c1
Sequence:CCGGCTGACGTGCAGAATATTATTTCTCGAGAAATAATATTCTGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080495.2-2481s21c1
Sequence:CCGGTGTCGCTGAGTAACGTCAAAGCTCGAGCTTTGACGTTACTCAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks