EMAIL THIS PAGE TO A FRIEND

TNRC18P2

trinucleotide repeat containing 18 pseudogene 2

Synonyms: TNRC18 TNRC18B
Species: Human TNRC18P2(27320)
Gene ID:
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51744 Anti-TNRC18 antibody produced in rabbit affinity isolated antibody mouse, rat, human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376618 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_376618 Rosetta Predictions human pricing
XM_499300 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479727 predicted 629
2 SASI_Hs02_00479728 predicted 568
3 SASI_Hs02_00479729 predicted 52
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_499300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480205 predicted 628
2 SASI_Hs02_00480206 predicted 561
3 SASI_Hs02_00480207 predicted 57
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376618
TNRC18P2 MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 18 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-403s21c1
Sequence:CCGGCAGTTGCTGCAGGAGATTATCCTCGAGGATAATCTCCTGCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-569s21c1
Sequence:CCGGAGTTTGACAACGGAGACACAGCTCGAGCTGTGTCTCCGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-1171s21c1
Sequence:CCGGCTGGATCACGAGGGTGTCATGCTCGAGCATGACACCCTCGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-558s21c1
Sequence:CCGGGACCACCGTGGAGTTTGACAACTCGAGTTGTCAAACTCCACGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-119s21c1
Sequence:CCGGAGGTGAAGAAGGAGAACCTCACTCGAGTGAGGTTCTCCTTCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376618
TNRC18P2 MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 18 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-403s21c1
Sequence:CCGGCAGTTGCTGCAGGAGATTATCCTCGAGGATAATCTCCTGCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-569s21c1
Sequence:CCGGAGTTTGACAACGGAGACACAGCTCGAGCTGTGTCTCCGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-1171s21c1
Sequence:CCGGCTGGATCACGAGGGTGTCATGCTCGAGCATGACACCCTCGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-558s21c1
Sequence:CCGGGACCACCGTGGAGTTTGACAACTCGAGTTGTCAAACTCCACGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-119s21c1
Sequence:CCGGAGGTGAAGAAGGAGAACCTCACTCGAGTGAGGTTCTCCTTCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376618
TNRC18P2 MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 18 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-403s21c1
Sequence:CCGGCAGTTGCTGCAGGAGATTATCCTCGAGGATAATCTCCTGCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-569s21c1
Sequence:CCGGAGTTTGACAACGGAGACACAGCTCGAGCTGTGTCTCCGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-1171s21c1
Sequence:CCGGCTGGATCACGAGGGTGTCATGCTCGAGCATGACACCCTCGTGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-558s21c1
Sequence:CCGGGACCACCGTGGAGTTTGACAACTCGAGTTGTCAAACTCCACGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_376618.5-119s21c1
Sequence:CCGGAGGTGAAGAAGGAGAACCTCACTCGAGTGAGGTTCTCCTTCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks