EMAIL THIS PAGE TO A FRIEND

TNRC6A

trinucleotide repeat containing 6A

Synonyms: CAGH26 GW1 GW182 TNRC6
Gene ID:
Human(27327) Summary: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The protein associates with messenger RNAs and Argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies. Inhibiting expression of this gene delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
Mouse(233833) trinucleotide repeat containing 6a
Rat(308971) trinucleotide repeat containing 6a
Zebrafish(571871) trinucleotide repeat containing 6a
chicken(416570) trinucleotide repeat containing 6A
domestic cat(101097775) trinucleotide repeat containing 6A
Horse(100069324) trinucleotide repeat containing 6A
dog(489966) trinucleotide repeat containing 6A
cow(541118) trinucleotide repeat containing 6A
sheep(101106899) trinucleotide repeat containing 6A
naked mole-rat(101724472) trinucleotide repeat containing 6A
domestic guinea pig(100719086) trinucleotide repeat containing 6A
241 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148841 MISSION® esiRNA esiRNA targeting mouse Tnrc6a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014494 Rosetta Predictions human pricing
NM_020847 Rosetta Predictions human pricing
NM_001107549 Rosetta Predictions rat pricing
NM_144925 Rosetta Predictions mouse pricing
XM_486002 Rosetta Predictions mouse pricing
XM_901687 Rosetta Predictions mouse pricing
XM_915472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244664 predicted 4631
2 SASI_Hs01_00244665 predicted 1486
3 SASI_Hs01_00244667 predicted 3815
4 SASI_Hs01_00244668 predicted 1792
5 SASI_Hs01_00244669 predicted 4767
6 SASI_Hs01_00244670 predicted 1754
7 SASI_Hs01_00244671 predicted 3318
8 SASI_Hs02_00345744 predicted 4745
9 SASI_Hs01_00244672 predicted 1313
10 SASI_Hs01_00244673 predicted 1932
11 SASI_Hs01_00244666 predicted 3888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039231 predicted 4531
2 SASI_Hs01_00039232 predicted 1375
3 SASI_Hs01_00039233 predicted 4245
4 SASI_Hs01_00039234 predicted 3706
5 SASI_Hs01_00039235 predicted 1676
6 SASI_Hs01_00039236 predicted 4665
7 SASI_Hs01_00039237 predicted 1646
8 SASI_Hs01_00039238 predicted 3211
9 SASI_Hs01_00039239 predicted 1203
10 SASI_Hs01_00039240 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229925 predicted 1228
2 SASI_Rn02_00229926 predicted 1397
3 SASI_Rn02_00229927 predicted 605
4 SASI_Rn02_00229928 predicted 5440
5 SASI_Rn02_00229929 predicted 4264
6 SASI_Rn02_00229930 predicted 1668
7 SASI_Rn02_00229931 predicted 2846
8 SASI_Rn02_00229932 predicted 4740
9 SASI_Rn02_00229933 predicted 920
10 SASI_Rn02_00229934 predicted 3623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340419 predicted 1766
2 SASI_Mm02_00340420 predicted 5658
3 SASI_Mm02_00340421 predicted 4491
4 SASI_Mm02_00340422 predicted 6012
5 SASI_Mm02_00340423 predicted 3389
6 SASI_Mm02_00340424 predicted 3206
7 SASI_Mm02_00340425 predicted 2036
8 SASI_Mm02_00340426 predicted 1865
9 SASI_Mm02_00340427 predicted 3101
10 SASI_Mm02_00340428 predicted 4970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223940 predicted 4560
2 SASI_Mm01_00223941 predicted 5197
3 SASI_Mm01_00223942 predicted 5535
4 SASI_Mm01_00223943 predicted 4361
5 SASI_Mm01_00223944 predicted 5185
6 SASI_Mm01_00223945 predicted 5191
7 SASI_Mm01_00223946 predicted 4816
8 SASI_Mm01_00223947 predicted 4776
9 SASI_Mm01_00223948 predicted 5033
10 SASI_Mm01_00223949 predicted 4965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219581 predicted 1078
2 SASI_Mm01_00219582 predicted 1714
3 SASI_Mm01_00219583 predicted 2050
4 SASI_Mm01_00219584 predicted 879
5 SASI_Mm01_00219585 predicted 1704
6 SASI_Mm01_00219586 predicted 1709
7 SASI_Mm01_00219587 predicted 1339
8 SASI_Mm01_00219588 predicted 1298
9 SASI_Mm01_00219589 predicted 1547
10 SASI_Mm01_00219590 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257576 predicted 4407
2 SASI_Mm01_00257577 predicted 5389
3 SASI_Mm01_00257578 predicted 4213
4 SASI_Mm01_00257579 predicted 5039
5 SASI_Mm01_00257580 predicted 5044
6 SASI_Mm01_00257581 predicted 4122
7 SASI_Mm01_00257582 predicted 4673
8 SASI_Mm01_00257583 predicted 4627
9 SASI_Mm01_00257584 predicted 4881
10 SASI_Mm01_00257585 predicted 4824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014494
VALIDATED
TNRC6A MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1762s21c1
Sequence:CCGGCTAATGCAGCCTGGCGTAAATCTCGAGATTTACGCCAGGCTGCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-1058s21c1
Sequence:CCGGTTTCCCATGGAGCCATAATAACTCGAGTTATTATGGCTCCATGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-602s21c1
Sequence:CCGGGATCTGCTGTTAAGGTGTTAACTCGAGTTAACACCTTAACAGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-5342s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-6161s21c1
Sequence:CCGGGAATCATGCAGGCCAATATTACTCGAGTAATATTGGCCTGCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1874s21c1
Sequence:CCGGGAAGTGGAAATGGCGCAAATTCTCGAGAATTTGCGCCATTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-685s1c1
Sequence:CCGGGCACTGTAAGTTCTTCATCAACTCGAGTTGATGAAGAACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-848s1c1
Sequence:CCGGGATGCCTAACAATCAGAGTATCTCGAGATACTCTGATTGTTAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-4312s1c1
Sequence:CCGGGCAAACATGGTGCTATTTCAACTCGAGTTGAAATAGCACCATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-5982s1c1
Sequence:CCGGCCAGTGTCAATGTTTACTCAACTCGAGTTGAGTAAACATTGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-6455s1c1
Sequence:CCGGCCCAAATCAAAGAGCATGGTTCTCGAGAACCATGCTCTTTGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-2622s1c1
Sequence:CCGGCCAGAATCTATACGTCGCAAACTCGAGTTTGCGACGTATAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-2478s1c1
Sequence:CCGGCCAGACTGGAACAAGCAACAACTCGAGTTGTTGCTTGTTCCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014494.1-1192s1c1
Sequence:CCGGGAGGCTCTTATGGTACTACATCTCGAGATGTAGTACCATAAGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014494
VALIDATED
TNRC6A MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1762s21c1
Sequence:CCGGCTAATGCAGCCTGGCGTAAATCTCGAGATTTACGCCAGGCTGCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-1058s21c1
Sequence:CCGGTTTCCCATGGAGCCATAATAACTCGAGTTATTATGGCTCCATGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-602s21c1
Sequence:CCGGGATCTGCTGTTAAGGTGTTAACTCGAGTTAACACCTTAACAGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-5342s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-6161s21c1
Sequence:CCGGGAATCATGCAGGCCAATATTACTCGAGTAATATTGGCCTGCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1874s21c1
Sequence:CCGGGAAGTGGAAATGGCGCAAATTCTCGAGAATTTGCGCCATTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-685s1c1
Sequence:CCGGGCACTGTAAGTTCTTCATCAACTCGAGTTGATGAAGAACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-848s1c1
Sequence:CCGGGATGCCTAACAATCAGAGTATCTCGAGATACTCTGATTGTTAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-4312s1c1
Sequence:CCGGGCAAACATGGTGCTATTTCAACTCGAGTTGAAATAGCACCATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-5982s1c1
Sequence:CCGGCCAGTGTCAATGTTTACTCAACTCGAGTTGAGTAAACATTGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-6455s1c1
Sequence:CCGGCCCAAATCAAAGAGCATGGTTCTCGAGAACCATGCTCTTTGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-2622s1c1
Sequence:CCGGCCAGAATCTATACGTCGCAAACTCGAGTTTGCGACGTATAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-2478s1c1
Sequence:CCGGCCAGACTGGAACAAGCAACAACTCGAGTTGTTGCTTGTTCCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014494.1-1192s1c1
Sequence:CCGGGAGGCTCTTATGGTACTACATCTCGAGATGTAGTACCATAAGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014494
VALIDATED
TNRC6A MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1762s21c1
Sequence:CCGGCTAATGCAGCCTGGCGTAAATCTCGAGATTTACGCCAGGCTGCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-1058s21c1
Sequence:CCGGTTTCCCATGGAGCCATAATAACTCGAGTTATTATGGCTCCATGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-602s21c1
Sequence:CCGGGATCTGCTGTTAAGGTGTTAACTCGAGTTAACACCTTAACAGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014494.2-5342s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-6161s21c1
Sequence:CCGGGAATCATGCAGGCCAATATTACTCGAGTAATATTGGCCTGCATGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014494.2-1874s21c1
Sequence:CCGGGAAGTGGAAATGGCGCAAATTCTCGAGAATTTGCGCCATTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-685s1c1
Sequence:CCGGGCACTGTAAGTTCTTCATCAACTCGAGTTGATGAAGAACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-848s1c1
Sequence:CCGGGATGCCTAACAATCAGAGTATCTCGAGATACTCTGATTGTTAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-4312s1c1
Sequence:CCGGGCAAACATGGTGCTATTTCAACTCGAGTTGAAATAGCACCATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-5982s1c1
Sequence:CCGGCCAGTGTCAATGTTTACTCAACTCGAGTTGAGTAAACATTGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014494.1-6455s1c1
Sequence:CCGGCCCAAATCAAAGAGCATGGTTCTCGAGAACCATGCTCTTTGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014494.1-2622s1c1
Sequence:CCGGCCAGAATCTATACGTCGCAAACTCGAGTTTGCGACGTATAGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014494.1-2478s1c1
Sequence:CCGGCCAGACTGGAACAAGCAACAACTCGAGTTGTTGCTTGTTCCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014494.1-1192s1c1
Sequence:CCGGGAGGCTCTTATGGTACTACATCTCGAGATGTAGTACCATAAGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144925
VALIDATED
TNRC6A MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-5476s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-1449s21c1
Sequence:CCGGTCATCAAATGGAGGGTTAAATCTCGAGATTTAACCCTCCATTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-1978s21c1
Sequence:CCGGCTAATTACTCTGGCGACAAATCTCGAGATTTGTCGCCAGAGTAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-3997s21c1
Sequence:CCGGGGATAAATCCATTCGTTAAACCTCGAGGTTTAACGAATGGATTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-6525s21c1
Sequence:CCGGCTCCGTCTAATCGGCAATATGCTCGAGCATATTGCCGATTAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144925
VALIDATED
TNRC6A MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-5476s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-1449s21c1
Sequence:CCGGTCATCAAATGGAGGGTTAAATCTCGAGATTTAACCCTCCATTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-1978s21c1
Sequence:CCGGCTAATTACTCTGGCGACAAATCTCGAGATTTGTCGCCAGAGTAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-3997s21c1
Sequence:CCGGGGATAAATCCATTCGTTAAACCTCGAGGTTTAACGAATGGATTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-6525s21c1
Sequence:CCGGCTCCGTCTAATCGGCAATATGCTCGAGCATATTGCCGATTAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144925
VALIDATED
TNRC6A MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-5476s21c1
Sequence:CCGGCCTTGTCTACGTGGGATAATTCTCGAGAATTATCCCACGTAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144925.3-1449s21c1
Sequence:CCGGTCATCAAATGGAGGGTTAAATCTCGAGATTTAACCCTCCATTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-1978s21c1
Sequence:CCGGCTAATTACTCTGGCGACAAATCTCGAGATTTGTCGCCAGAGTAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-3997s21c1
Sequence:CCGGGGATAAATCCATTCGTTAAACCTCGAGGTTTAACGAATGGATTTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144925.3-6525s21c1
Sequence:CCGGCTCCGTCTAATCGGCAATATGCTCGAGCATATTGCCGATTAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks