EMAIL THIS PAGE TO A FRIEND

TNRC6B

trinucleotide repeat containing 6B

UniProtKB ID: Q9UPQ9, B0QY73, B0QY78, B4DGC0, Q5TH52, Q8TBX2
Gene ID:
Mouse(213988) trinucleotide repeat containing 6b
Rat(192178) trinucleotide repeat containing 6B
domestic guinea pig(100712830) trinucleotide repeat containing 6B
naked mole-rat(101720757) trinucleotide repeat containing 6B
cow(528167) trinucleotide repeat containing 6B
sheep(101107854) trinucleotide repeat containing 6B
Zebrafish(321362) trinucleotide repeat containing 6b
chicken(418010) trinucleotide repeat containing 6B
domestic cat(101085054) trinucleotide repeat containing 6B
Horse(100070414) trinucleotide repeat containing 6B
dog(481240) trinucleotide repeat containing 6B
417 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024843 Rosetta Predictions human pricing
NM_015088 Rosetta Predictions human pricing
NM_138845 Rosetta Predictions rat pricing
NM_144812 Rosetta Predictions mouse pricing
NM_177124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158384 predicted 2910
2 SASI_Hs01_00158385 predicted 2525
3 SASI_Hs01_00158386 predicted 2564
4 SASI_Hs01_00158387 predicted 1596
5 SASI_Hs01_00158388 predicted 2482
6 SASI_Hs01_00158389 predicted 1230
7 SASI_Hs01_00158390 predicted 2559
8 SASI_Hs01_00158391 predicted 2458
9 SASI_Hs01_00158392 predicted 3033
10 SASI_Hs01_00158393 predicted 2417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187971 predicted 4898
2 SASI_Hs01_00187972 predicted 4516
3 SASI_Hs01_00187973 predicted 4557
4 SASI_Hs01_00187974 predicted 3588
5 SASI_Hs01_00187975 predicted 4472
6 SASI_Hs01_00187976 predicted 3217
7 SASI_Hs01_00187977 predicted 4556
8 SASI_Hs01_00187978 predicted 4446
9 SASI_Hs01_00187979 predicted 5022
10 SASI_Hs01_00187980 predicted 4410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268227 predicted 1548
2 SASI_Rn02_00268228 predicted 4557
3 SASI_Rn02_00268229 predicted 3129
4 SASI_Rn02_00268230 predicted 1467
5 SASI_Rn02_00268231 predicted 4945
6 SASI_Rn02_00268232 predicted 3577
7 SASI_Rn02_00268233 predicted 4636
8 SASI_Rn02_00268234 predicted 4576
9 SASI_Rn02_00268235 predicted 2778
10 SASI_Rn02_00268236 predicted 4838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183866 predicted 1337
2 SASI_Mm02_00340172 predicted 4859
3 SASI_Mm01_00183867 predicted 1528
4 SASI_Mm01_00183869 predicted 3338
5 SASI_Mm01_00183871 predicted 3556
6 SASI_Mm01_00183872 predicted 4588
7 SASI_Mm01_00183873 predicted 1484
8 SASI_Mm01_00183874 predicted 4533
9 SASI_Mm02_00340173 predicted 4787
10 SASI_Mm01_00183875 predicted 940
11 SASI_Mm01_00183868 predicted 3111
12 SASI_Mm01_00183870 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103134 predicted 1131
2 SASI_Mm02_00347119 predicted 4654
3 SASI_Mm01_00103135 predicted 1320
4 SASI_Mm01_00103137 predicted 3132
5 SASI_Mm01_00103139 predicted 3353
6 SASI_Mm01_00103140 predicted 4386
7 SASI_Mm01_00103141 predicted 1268
8 SASI_Mm01_00103142 predicted 4322
9 SASI_Mm02_00347120 predicted 4580
10 SASI_Mm01_00103143 predicted 730
11 SASI_Mm01_00103136 predicted 2790
12 SASI_Mm01_00103138 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015088
TNRC6B MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015088.1-13087s1c1
Sequence:CCGGGCAGGTTTACACATCTGCATTCTCGAGAATGCAGATGTGTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3248s1c1
Sequence:CCGGGCTGAGTCAGACTGAAGATAACTCGAGTTATCTTCAGTCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-842s1c1
Sequence:CCGGCGATAACAACAGTGCCTCGAACTCGAGTTCGAGGCACTGTTGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3579s1c1
Sequence:CCGGGCCTCAATGCTCAAGCAGTTTCTCGAGAAACTGCTTGAGCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015088.1-11329s1c1
Sequence:CCGGGCGCACTACATTTACTTCTTTCTCGAGAAAGAAGTAAATGTAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-2212s1c1
Sequence:CCGGGCAATCAAATGAAGTCTGGATCTCGAGATCCAGACTTCATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-4051s21c1
Sequence:CCGGTGGAACCGAGTCTCGCTTTAACTCGAGTTAAAGCGAGACTCGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-3436s21c1
Sequence:CCGGCACAGATAGTGGGCCTTATTTCTCGAGAAATAAGGCCCACTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015088
TNRC6B MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015088.1-13087s1c1
Sequence:CCGGGCAGGTTTACACATCTGCATTCTCGAGAATGCAGATGTGTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3248s1c1
Sequence:CCGGGCTGAGTCAGACTGAAGATAACTCGAGTTATCTTCAGTCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-842s1c1
Sequence:CCGGCGATAACAACAGTGCCTCGAACTCGAGTTCGAGGCACTGTTGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3579s1c1
Sequence:CCGGGCCTCAATGCTCAAGCAGTTTCTCGAGAAACTGCTTGAGCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015088.1-11329s1c1
Sequence:CCGGGCGCACTACATTTACTTCTTTCTCGAGAAAGAAGTAAATGTAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-2212s1c1
Sequence:CCGGGCAATCAAATGAAGTCTGGATCTCGAGATCCAGACTTCATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-4051s21c1
Sequence:CCGGTGGAACCGAGTCTCGCTTTAACTCGAGTTAAAGCGAGACTCGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-3436s21c1
Sequence:CCGGCACAGATAGTGGGCCTTATTTCTCGAGAAATAAGGCCCACTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015088
TNRC6B MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015088.1-13087s1c1
Sequence:CCGGGCAGGTTTACACATCTGCATTCTCGAGAATGCAGATGTGTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3248s1c1
Sequence:CCGGGCTGAGTCAGACTGAAGATAACTCGAGTTATCTTCAGTCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-842s1c1
Sequence:CCGGCGATAACAACAGTGCCTCGAACTCGAGTTCGAGGCACTGTTGTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-3579s1c1
Sequence:CCGGGCCTCAATGCTCAAGCAGTTTCTCGAGAAACTGCTTGAGCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015088.1-11329s1c1
Sequence:CCGGGCGCACTACATTTACTTCTTTCTCGAGAAAGAAGTAAATGTAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015088.1-2212s1c1
Sequence:CCGGGCAATCAAATGAAGTCTGGATCTCGAGATCCAGACTTCATTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-4051s21c1
Sequence:CCGGTGGAACCGAGTCTCGCTTTAACTCGAGTTAAAGCGAGACTCGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015088.2-3436s21c1
Sequence:CCGGCACAGATAGTGGGCCTTATTTCTCGAGAAATAAGGCCCACTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177124
TNRC6B MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-1815s1c1
Sequence:CCGGGCAACCACAAAGCAGGAAGTACTCGAGTACTTCCTGCTTTGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-2717s1c1
Sequence:CCGGCCACAGTCAATTAGTCGGAAACTCGAGTTTCCGACTAATTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-3292s1c1
Sequence:CCGGGCTGAGTCAAACTGAGGATAACTCGAGTTATCCTCAGTTTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-4634s1c1
Sequence:CCGGCCTCTTTATTACCAGCATTTACTCGAGTAAATGCTGGTAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177124.3-4975s1c1
Sequence:CCGGCCTAGAGACATAATGAAAGTACTCGAGTACTTTCATTATGTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177124
TNRC6B MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-1815s1c1
Sequence:CCGGGCAACCACAAAGCAGGAAGTACTCGAGTACTTCCTGCTTTGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-2717s1c1
Sequence:CCGGCCACAGTCAATTAGTCGGAAACTCGAGTTTCCGACTAATTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-3292s1c1
Sequence:CCGGGCTGAGTCAAACTGAGGATAACTCGAGTTATCCTCAGTTTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-4634s1c1
Sequence:CCGGCCTCTTTATTACCAGCATTTACTCGAGTAAATGCTGGTAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177124.3-4975s1c1
Sequence:CCGGCCTAGAGACATAATGAAAGTACTCGAGTACTTTCATTATGTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177124
TNRC6B MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-1815s1c1
Sequence:CCGGGCAACCACAAAGCAGGAAGTACTCGAGTACTTCCTGCTTTGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-2717s1c1
Sequence:CCGGCCACAGTCAATTAGTCGGAAACTCGAGTTTCCGACTAATTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-3292s1c1
Sequence:CCGGGCTGAGTCAAACTGAGGATAACTCGAGTTATCCTCAGTTTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177124.3-4634s1c1
Sequence:CCGGCCTCTTTATTACCAGCATTTACTCGAGTAAATGCTGGTAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177124.3-4975s1c1
Sequence:CCGGCCTAGAGACATAATGAAAGTACTCGAGTACTTTCATTATGTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks