EMAIL THIS PAGE TO A FRIEND

TNRC6C

trinucleotide repeat containing 6C

UniProtKB ID: Q9HCJ0, Q86UE5, Q8N3D8, Q96MU9
Gene ID:
Mouse(217351) trinucleotide repeat containing 6C
Zebrafish(560874) trinucleotide repeat containing 6C
chicken(417348) trinucleotide repeat containing 6C
Horse(100058134) trinucleotide repeat containing 6C
domestic cat(101100852) trinucleotide repeat containing 6C
dog(483340) trinucleotide repeat containing 6C
cow(504217) trinucleotide repeat containing 6C
sheep(101115294) trinucleotide repeat containing 6C
naked mole-rat(101726218) trinucleotide repeat containing 6C
domestic guinea pig(100729708) trinucleotide repeat containing 6C
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018996 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018996 Rosetta Predictions human pricing
NM_198022 Rosetta Predictions mouse pricing
XM_001004977 Rosetta Predictions mouse pricing
XM_126551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064530 predicted 3707
2 SASI_Hs01_00064531 predicted 4156
3 SASI_Hs01_00064532 predicted 3581
4 SASI_Hs01_00064533 predicted 3666
5 SASI_Hs02_00352503 predicted 4759
6 SASI_Hs01_00064534 predicted 828
7 SASI_Hs01_00064535 predicted 648
8 SASI_Hs01_00064536 predicted 926
9 SASI_Hs01_00064537 predicted 4173
10 SASI_Hs01_00064538 predicted 1092
11 SASI_Hs01_00064539 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350737 predicted 1838
2 SASI_Mm02_00350738 predicted 5089
3 SASI_Mm02_00350739 predicted 5062
4 SASI_Mm02_00350740 predicted 4487
5 SASI_Mm02_00350741 predicted 2685
6 SASI_Mm02_00350742 predicted 5365
7 SASI_Mm02_00350743 predicted 5629
8 SASI_Mm02_00350744 predicted 1889
9 SASI_Mm02_00350745 predicted 2008
10 SASI_Mm02_00350746 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249537 predicted 4629
2 SASI_Mm01_00249538 predicted 1852
3 SASI_Mm01_00249539 predicted 5088
4 SASI_Mm01_00249540 predicted 4495
5 SASI_Mm01_00249541 predicted 2696
6 SASI_Mm01_00249542 predicted 5376
7 SASI_Mm01_00249543 predicted 5638
8 SASI_Mm01_00249544 predicted 1893
9 SASI_Mm01_00249545 predicted 2016
10 SASI_Mm01_00249546 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264773 predicted 4627
2 SASI_Mm01_00264774 predicted 1840
3 SASI_Mm01_00264775 predicted 5086
4 SASI_Mm01_00264776 predicted 5069
5 SASI_Mm01_00264777 predicted 4487
6 SASI_Mm01_00264778 predicted 2688
7 SASI_Mm01_00264779 predicted 5372
8 SASI_Mm01_00264780 predicted 5638
9 SASI_Mm01_00264781 predicted 1893
10 SASI_Mm01_00264782 predicted 2015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198022
VALIDATED
TNRC6C MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4475s21c1
Sequence:CCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-579s21c1
Sequence:CCGGTACTTCCACCAGCACTATTTCCTCGAGGAAATAGTGCTGGTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-858s21c1
Sequence:CCGGCAGTGGATTGGTAGATCATTACTCGAGTAATGATCTACCAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4627s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-6442s21c1
Sequence:CCGGGTGGGCTGGAAAGGGTTATTTCTCGAGAAATAACCCTTTCCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198022
VALIDATED
TNRC6C MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4475s21c1
Sequence:CCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-579s21c1
Sequence:CCGGTACTTCCACCAGCACTATTTCCTCGAGGAAATAGTGCTGGTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-858s21c1
Sequence:CCGGCAGTGGATTGGTAGATCATTACTCGAGTAATGATCTACCAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4627s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-6442s21c1
Sequence:CCGGGTGGGCTGGAAAGGGTTATTTCTCGAGAAATAACCCTTTCCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198022
VALIDATED
TNRC6C MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4475s21c1
Sequence:CCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-579s21c1
Sequence:CCGGTACTTCCACCAGCACTATTTCCTCGAGGAAATAGTGCTGGTGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-858s21c1
Sequence:CCGGCAGTGGATTGGTAGATCATTACTCGAGTAATGATCTACCAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-4627s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198022.2-6442s21c1
Sequence:CCGGGTGGGCTGGAAAGGGTTATTTCTCGAGAAATAACCCTTTCCAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018996
VALIDATED
TNRC6C MISSION shRNA Bacterial Glycerol Stock
trinucleotide repeat containing 6C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4179s21c1
Sequence:CCGGCTATGGCCGGTACGATTTAATCTCGAGATTAAATCGTACCGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3712s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3560s21c1
Sequence:GTACCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4122s21c1
Sequence:CCGGTGCTATCCCTGGAGGTCTAAGCTCGAGCTTAGACCTCCAGGGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-1401s21c1
Sequence:CCGGAGAAGGCCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1408s1c1
Sequence:CCGGCGAAGGCGAGATAAAGGGATTCTCGAGAATCCCTTTATCTCGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-3557s1c1
Sequence:CCGGCTGCACTATTAACCTCGCCAACTCGAGTTGGCGAGGTTAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018996.x-5229s1c1
Sequence:CCGGGCCATCATCAGCACCAGGAGACTCGAGTCTCCTGGTGCTGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018996.x-4764s1c1
Sequence:CCGGGCCTCTTATCACATTCCACCTCTCGAGAGGTGGAATGTGATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1194s1c1
Sequence:CCGGCCAGCATTCCAACAGTGACATCTCGAGATGTCACTGTTGGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018996
VALIDATED
TNRC6C MISSION shRNA shRNA Plasmid DNA
trinucleotide repeat containing 6C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4179s21c1
Sequence:CCGGCTATGGCCGGTACGATTTAATCTCGAGATTAAATCGTACCGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3712s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3560s21c1
Sequence:GTACCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4122s21c1
Sequence:CCGGTGCTATCCCTGGAGGTCTAAGCTCGAGCTTAGACCTCCAGGGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-1401s21c1
Sequence:CCGGAGAAGGCCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1408s1c1
Sequence:CCGGCGAAGGCGAGATAAAGGGATTCTCGAGAATCCCTTTATCTCGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-3557s1c1
Sequence:CCGGCTGCACTATTAACCTCGCCAACTCGAGTTGGCGAGGTTAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018996.x-5229s1c1
Sequence:CCGGGCCATCATCAGCACCAGGAGACTCGAGTCTCCTGGTGCTGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018996.x-4764s1c1
Sequence:CCGGGCCTCTTATCACATTCCACCTCTCGAGAGGTGGAATGTGATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1194s1c1
Sequence:CCGGCCAGCATTCCAACAGTGACATCTCGAGATGTCACTGTTGGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018996
VALIDATED
TNRC6C MISSION shRNA Lentiviral Transduction Particles
trinucleotide repeat containing 6C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4179s21c1
Sequence:CCGGCTATGGCCGGTACGATTTAATCTCGAGATTAAATCGTACCGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3712s21c1
Sequence:CCGGGTTGCGCGCACAATCACTAATCTCGAGATTAGTGATTGTGCGCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-3560s21c1
Sequence:GTACCGGCACTATTAACCTCGCCAATTACTCGAGTAATTGGCGAGGTTAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-4122s21c1
Sequence:CCGGTGCTATCCCTGGAGGTCTAAGCTCGAGCTTAGACCTCCAGGGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018996.2-1401s21c1
Sequence:CCGGAGAAGGCCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1408s1c1
Sequence:CCGGCGAAGGCGAGATAAAGGGATTCTCGAGAATCCCTTTATCTCGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-3557s1c1
Sequence:CCGGCTGCACTATTAACCTCGCCAACTCGAGTTGGCGAGGTTAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018996.x-5229s1c1
Sequence:CCGGGCCATCATCAGCACCAGGAGACTCGAGTCTCCTGGTGCTGATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018996.x-4764s1c1
Sequence:CCGGGCCTCTTATCACATTCCACCTCTCGAGAGGTGGAATGTGATAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018996.x-1194s1c1
Sequence:CCGGCCAGCATTCCAACAGTGACATCTCGAGATGTCACTGTTGGAATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks