EMAIL THIS PAGE TO A FRIEND

TNS1

tensin 1

Synonyms: MST091 MST122 MST127 MSTP122 MSTP127 MXRA6 TNS
UniProtKB ID: Q9HBL0, Q4ZG71
Gene ID:
Human(7145) Summary: The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. A second transcript from this gene has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(21961) tensin 1
Rat(301509) tensin 1
dog(488519) tensin 1
Horse(100058067) tensin 1
chicken(396439) tensin 1
cow(286798) tensin 1
sheep(101109946) tensin 1
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022648 Rosetta Predictions human pricing
XM_237286 Rosetta Predictions rat pricing
XM_619639 Rosetta Predictions mouse pricing
XM_984786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199914 predicted 4704
2 SASI_Hs01_00199916 predicted 4918
3 SASI_Hs01_00199917 predicted 5021
4 SASI_Hs01_00199918 predicted 876
5 SASI_Hs01_00199919 predicted 755
6 SASI_Hs01_00199920 predicted 937
7 SASI_Hs01_00199921 predicted 696
8 SASI_Hs01_00199922 predicted 3775
9 SASI_Hs02_00355909 predicted 1872
10 SASI_Hs02_00355910 predicted 831
11 SASI_Hs01_00199915 predicted 5350
12 SASI_Hs01_00199923 predicted 3152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390797 predicted 4806
2 SASI_Rn02_00390798 predicted 2129
3 SASI_Rn02_00390799 predicted 5284
4 SASI_Rn02_00390800 predicted 1717
5 SASI_Rn02_00390801 predicted 2189
6 SASI_Rn02_00390802 predicted 2082
7 SASI_Rn02_00390803 predicted 3541
8 SASI_Rn02_00390804 predicted 4204
9 SASI_Rn02_00390805 predicted 643
10 SASI_Rn02_00390806 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271339 predicted 5385
2 SASI_Mm02_00427469 predicted 5250
3 SASI_Mm01_00271341 predicted 5244
4 SASI_Mm01_00271342 predicted 4512
5 SASI_Mm01_00271343 predicted 4685
6 SASI_Mm01_00271344 predicted 4612
7 SASI_Mm01_00271345 predicted 4941
8 SASI_Mm01_00271346 predicted 5145
9 SASI_Mm01_00271347 predicted 3881
10 SASI_Mm01_00271348 predicted 5383
11 SASI_Mm01_00271340 predicted 4774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448589 predicted 355
2 SASI_Mm02_00448590 predicted 5012
3 SASI_Mm02_00448591 predicted 711
4 SASI_Mm02_00448592 predicted 2482
5 SASI_Mm02_00448593 predicted 1532
6 SASI_Mm02_00448594 predicted 4045
7 SASI_Mm02_00448595 predicted 741
8 SASI_Mm02_00448596 predicted 2073
9 SASI_Mm02_00448597 predicted 1085
10 SASI_Mm02_00448598 predicted 4131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022648
VALIDATED
TNS1 MISSION shRNA Bacterial Glycerol Stock
tensin 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-5263s1c1
Sequence:CCGGGCCACCATCGTTCACTTCAAACTCGAGTTTGAAGTGAACGATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-814s1c1
Sequence:CCGGGAGGATAAGATTGTGCCCATTCTCGAGAATGGGCACAATCTTATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-845s1c1
Sequence:CCGGCCCAAAGAAGGTACGTGCATTCTCGAGAATGCACGTACCTTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022648.x-6197s1c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-3803s1c1
Sequence:CCGGCCGACTACTCACTTCAGCATTCTCGAGAATGCTGAAGTGAGTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022648.4-5947s21c1
Sequence:CCGGCCTCCTTGGGAATCCACATTTCTCGAGAAATGTGGATTCCCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-1361s21c1
Sequence:CCGGGAGCGTGTCTGTGGACTATAACTCGAGTTATAGTCCACAGACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-778s21c1
Sequence:GTACCGGACATGCACTACAGCAACATTTCTCGAGAAATGTTGCTGTAGTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-829s21c1
Sequence:CCGGTTGCAATGAAGCGGTTCTATGCTCGAGCATAGAACCGCTTCATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2044s21c1
Sequence:CCGGCCATGGAGCCTATGGTCAATGCTCGAGCATTGACCATAGGCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-6226s21c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-4358s21c1
Sequence:CCGGTGTGGCCTATGGTGGCTATTCCTCGAGGAATAGCCACCATAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2679s21c1
Sequence:CCGGCAGTCCAGATCTGGCTATATCCTCGAGGATATAGCCAGATCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022648
VALIDATED
TNS1 MISSION shRNA shRNA Plasmid DNA
tensin 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-5263s1c1
Sequence:CCGGGCCACCATCGTTCACTTCAAACTCGAGTTTGAAGTGAACGATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-814s1c1
Sequence:CCGGGAGGATAAGATTGTGCCCATTCTCGAGAATGGGCACAATCTTATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-845s1c1
Sequence:CCGGCCCAAAGAAGGTACGTGCATTCTCGAGAATGCACGTACCTTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022648.x-6197s1c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-3803s1c1
Sequence:CCGGCCGACTACTCACTTCAGCATTCTCGAGAATGCTGAAGTGAGTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022648.4-5947s21c1
Sequence:CCGGCCTCCTTGGGAATCCACATTTCTCGAGAAATGTGGATTCCCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-1361s21c1
Sequence:CCGGGAGCGTGTCTGTGGACTATAACTCGAGTTATAGTCCACAGACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-778s21c1
Sequence:GTACCGGACATGCACTACAGCAACATTTCTCGAGAAATGTTGCTGTAGTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-829s21c1
Sequence:CCGGTTGCAATGAAGCGGTTCTATGCTCGAGCATAGAACCGCTTCATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2044s21c1
Sequence:CCGGCCATGGAGCCTATGGTCAATGCTCGAGCATTGACCATAGGCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-6226s21c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-4358s21c1
Sequence:CCGGTGTGGCCTATGGTGGCTATTCCTCGAGGAATAGCCACCATAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2679s21c1
Sequence:CCGGCAGTCCAGATCTGGCTATATCCTCGAGGATATAGCCAGATCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022648
VALIDATED
TNS1 MISSION shRNA Lentiviral Transduction Particles
tensin 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-5263s1c1
Sequence:CCGGGCCACCATCGTTCACTTCAAACTCGAGTTTGAAGTGAACGATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-814s1c1
Sequence:CCGGGAGGATAAGATTGTGCCCATTCTCGAGAATGGGCACAATCTTATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-845s1c1
Sequence:CCGGCCCAAAGAAGGTACGTGCATTCTCGAGAATGCACGTACCTTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022648.x-6197s1c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022648.x-3803s1c1
Sequence:CCGGCCGACTACTCACTTCAGCATTCTCGAGAATGCTGAAGTGAGTAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022648.4-5947s21c1
Sequence:CCGGCCTCCTTGGGAATCCACATTTCTCGAGAAATGTGGATTCCCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-1361s21c1
Sequence:CCGGGAGCGTGTCTGTGGACTATAACTCGAGTTATAGTCCACAGACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-778s21c1
Sequence:GTACCGGACATGCACTACAGCAACATTTCTCGAGAAATGTTGCTGTAGTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-829s21c1
Sequence:CCGGTTGCAATGAAGCGGTTCTATGCTCGAGCATAGAACCGCTTCATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2044s21c1
Sequence:CCGGCCATGGAGCCTATGGTCAATGCTCGAGCATTGACCATAGGCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022648.4-6226s21c1
Sequence:CCGGGCCTTTATCCACTCGAATTATCTCGAGATAATTCGAGTGGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-4358s21c1
Sequence:CCGGTGTGGCCTATGGTGGCTATTCCTCGAGGAATAGCCACCATAGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022648.4-2679s21c1
Sequence:CCGGCAGTCCAGATCTGGCTATATCCTCGAGGATATAGCCAGATCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks