EMAIL THIS PAGE TO A FRIEND
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001083587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001083587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001083587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_109868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022748 Rosetta Predictions human pricing
XM_341256 Rosetta Predictions rat pricing
NM_001083587 Rosetta Predictions mouse pricing
XM_109868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166414 predicted 1783
2 SASI_Hs01_00166415 predicted 1339
3 SASI_Hs01_00166416 predicted 3811
4 SASI_Hs02_00356003 predicted 3875
5 SASI_Hs01_00166417 predicted 2885
6 SASI_Hs01_00166418 predicted 3765
7 SASI_Hs01_00166419 predicted 990
8 SASI_Hs01_00166420 predicted 500
9 SASI_Hs01_00166421 predicted 698
10 SASI_Hs01_00166422 predicted 4593
11 SASI_Hs01_00166423 predicted 3907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392645 predicted 948
2 SASI_Rn02_00392646 predicted 936
3 SASI_Rn02_00392647 predicted 693
4 SASI_Rn02_00392648 predicted 586
5 SASI_Rn02_00392649 predicted 625
6 SASI_Rn02_00392650 predicted 718
7 SASI_Rn02_00392651 predicted 657
8 SASI_Rn02_00392652 predicted 858
9 SASI_Rn02_00392653 predicted 867
10 SASI_Rn02_00392654 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299711 predicted 494
2 SASI_Mm02_00299712 predicted 454
3 SASI_Mm02_00299713 predicted 2747
4 SASI_Mm02_00299714 predicted 4704
5 SASI_Mm02_00299715 predicted 1651
6 SASI_Mm02_00299716 predicted 4100
7 SASI_Mm02_00299717 predicted 4531
8 SASI_Mm02_00299718 predicted 2925
9 SASI_Mm02_00299719 predicted 4300
10 SASI_Mm02_00299720 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285900 predicted 630
2 SASI_Mm01_00285901 predicted 4369
3 SASI_Mm01_00285902 predicted 586
4 SASI_Mm01_00285903 predicted 2878
5 SASI_Mm01_00285904 predicted 4839
6 SASI_Mm01_00285905 predicted 1786
7 SASI_Mm01_00285906 predicted 4236
8 SASI_Mm01_00285907 predicted 4667
9 SASI_Mm01_00285908 predicted 3054
10 SASI_Mm01_00285909 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022748
VALIDATED
TNS3 MISSION shRNA Bacterial Glycerol Stock
tensin 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-703s21c1
Sequence:CCGGACGCATAGGAGTGGTCATATCCTCGAGGATATGACCACTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2346s21c1
Sequence:CCGGCTCCCAGCAAAGCGTTCAAACCTCGAGGTTTGAACGCTTTGCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022748.10-505s21c1
Sequence:GTACCGGGGACAACTACCTGGTATTAAACTCGAGTTTAATACCAGGTAGTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-1235s21c1
Sequence:GTACCGGGACTATGGGAAGGTTGAATTACTCGAGTAATTCAACCTTCCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2152s21c1
Sequence:CCGGGGTTGTAGCTCACCAGTATAGCTCGAGCTATACTGGTGAGCTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-3308s1c1
Sequence:CCGGCGTGTGGTACTTGAACTCTGTCTCGAGACAGAGTTCAAGTACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-2882s1c1
Sequence:CCGGGTTCTGGTACAAGGCGGATATCTCGAGATATCCGCCTTGTACCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-2824s1c1
Sequence:CCGGTGCCAGATAGTCCAGGTGATACTCGAGTATCACCTGGACTATCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022748.x-5021s1c1
Sequence:CCGGCCACTGTTTGCCATCATCTAACTCGAGTTAGATGATGGCAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-916s1c1
Sequence:CCGGGCAGCCAGAACTCACTCCTATCTCGAGATAGGAGTGAGTTCTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022748
VALIDATED
TNS3 MISSION shRNA shRNA Plasmid DNA
tensin 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-703s21c1
Sequence:CCGGACGCATAGGAGTGGTCATATCCTCGAGGATATGACCACTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2346s21c1
Sequence:CCGGCTCCCAGCAAAGCGTTCAAACCTCGAGGTTTGAACGCTTTGCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022748.10-505s21c1
Sequence:GTACCGGGGACAACTACCTGGTATTAAACTCGAGTTTAATACCAGGTAGTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-1235s21c1
Sequence:GTACCGGGACTATGGGAAGGTTGAATTACTCGAGTAATTCAACCTTCCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2152s21c1
Sequence:CCGGGGTTGTAGCTCACCAGTATAGCTCGAGCTATACTGGTGAGCTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-3308s1c1
Sequence:CCGGCGTGTGGTACTTGAACTCTGTCTCGAGACAGAGTTCAAGTACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-2882s1c1
Sequence:CCGGGTTCTGGTACAAGGCGGATATCTCGAGATATCCGCCTTGTACCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-2824s1c1
Sequence:CCGGTGCCAGATAGTCCAGGTGATACTCGAGTATCACCTGGACTATCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022748.x-5021s1c1
Sequence:CCGGCCACTGTTTGCCATCATCTAACTCGAGTTAGATGATGGCAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-916s1c1
Sequence:CCGGGCAGCCAGAACTCACTCCTATCTCGAGATAGGAGTGAGTTCTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022748
VALIDATED
TNS3 MISSION shRNA Lentiviral Transduction Particles
tensin 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-703s21c1
Sequence:CCGGACGCATAGGAGTGGTCATATCCTCGAGGATATGACCACTCCTATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2346s21c1
Sequence:CCGGCTCCCAGCAAAGCGTTCAAACCTCGAGGTTTGAACGCTTTGCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022748.10-505s21c1
Sequence:GTACCGGGGACAACTACCTGGTATTAAACTCGAGTTTAATACCAGGTAGTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-1235s21c1
Sequence:GTACCGGGACTATGGGAAGGTTGAATTACTCGAGTAATTCAACCTTCCCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022748.10-2152s21c1
Sequence:CCGGGGTTGTAGCTCACCAGTATAGCTCGAGCTATACTGGTGAGCTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-3308s1c1
Sequence:CCGGCGTGTGGTACTTGAACTCTGTCTCGAGACAGAGTTCAAGTACCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022748.x-2882s1c1
Sequence:CCGGGTTCTGGTACAAGGCGGATATCTCGAGATATCCGCCTTGTACCAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-2824s1c1
Sequence:CCGGTGCCAGATAGTCCAGGTGATACTCGAGTATCACCTGGACTATCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022748.x-5021s1c1
Sequence:CCGGCCACTGTTTGCCATCATCTAACTCGAGTTAGATGATGGCAAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022748.x-916s1c1
Sequence:CCGGGCAGCCAGAACTCACTCCTATCTCGAGATAGGAGTGAGTTCTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083587
TNS3 MISSION shRNA Bacterial Glycerol Stock
tensin 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000216749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-455s1c1
Sequence:CCGGGAGACAACTACCTGGTATTAACTCGAGTTAATACCAGGTAGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001083587.1-7216s1c1
Sequence:CCGGCCTTCTCATTAACGGTCTTATCTCGAGATAAGACCGTTAATGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-2051s1c1
Sequence:CCGGCCTATGGGCAAAGTAACTATTCTCGAGAATAGTTACTTTGCCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083587
TNS3 MISSION shRNA shRNA Plasmid DNA
tensin 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000216749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-455s1c1
Sequence:CCGGGAGACAACTACCTGGTATTAACTCGAGTTAATACCAGGTAGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001083587.1-7216s1c1
Sequence:CCGGCCTTCTCATTAACGGTCTTATCTCGAGATAAGACCGTTAATGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-2051s1c1
Sequence:CCGGCCTATGGGCAAAGTAACTATTCTCGAGAATAGTTACTTTGCCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083587
TNS3 MISSION shRNA Lentiviral Transduction Particles
tensin 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000216749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-455s1c1
Sequence:CCGGGAGACAACTACCTGGTATTAACTCGAGTTAATACCAGGTAGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217821    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001083587.1-7216s1c1
Sequence:CCGGCCTTCTCATTAACGGTCTTATCTCGAGATAAGACCGTTAATGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001083587.1-2051s1c1
Sequence:CCGGCCTATGGGCAAAGTAACTATTCTCGAGAATAGTTACTTTGCCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109868
VALIDATED
TNS3 MISSION shRNA Bacterial Glycerol Stock
tensin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109868.4-4297s1c1
Sequence:CCGGGCTGGAGATTTGTCCAATGAACTCGAGTTCATTGGACAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-465s1c1
Sequence:CCGGGAAGAGATATGACCTTACAAACTCGAGTTTGTAAGGTCATATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-4083s1c1
Sequence:CCGGCCCAAATGATAAACTCGTGATCTCGAGATCACGAGTTTATCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1863s1c1
Sequence:CCGGCCACAAAGACATGACTGATATCTCGAGATATCAGTCATGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1741s1c1
Sequence:CCGGGCCAGGACTGATAAGACAGAACTCGAGTTCTGTCTTATCAGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109868
VALIDATED
TNS3 MISSION shRNA shRNA Plasmid DNA
tensin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109868.4-4297s1c1
Sequence:CCGGGCTGGAGATTTGTCCAATGAACTCGAGTTCATTGGACAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-465s1c1
Sequence:CCGGGAAGAGATATGACCTTACAAACTCGAGTTTGTAAGGTCATATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-4083s1c1
Sequence:CCGGCCCAAATGATAAACTCGTGATCTCGAGATCACGAGTTTATCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1863s1c1
Sequence:CCGGCCACAAAGACATGACTGATATCTCGAGATATCAGTCATGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1741s1c1
Sequence:CCGGGCCAGGACTGATAAGACAGAACTCGAGTTCTGTCTTATCAGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109868
VALIDATED
TNS3 MISSION shRNA Lentiviral Transduction Particles
tensin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109868.4-4297s1c1
Sequence:CCGGGCTGGAGATTTGTCCAATGAACTCGAGTTCATTGGACAAATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-465s1c1
Sequence:CCGGGAAGAGATATGACCTTACAAACTCGAGTTTGTAAGGTCATATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-4083s1c1
Sequence:CCGGCCCAAATGATAAACTCGTGATCTCGAGATCACGAGTTTATCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1863s1c1
Sequence:CCGGCCACAAAGACATGACTGATATCTCGAGATATCAGTCATGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_109868.4-1741s1c1
Sequence:CCGGGCCAGGACTGATAAGACAGAACTCGAGTTCTGTCTTATCAGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks