EMAIL THIS PAGE TO A FRIEND

TNS4

tensin 4

Synonyms: CTEN
UniProtKB ID: Q8IZW8, A6NMJ7, Q71RB7, Q8WV64, Q96JV4
Gene Class: Cytoskeleton
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032865 Rosetta Predictions human pricing
NM_001024881 Rosetta Predictions rat pricing
NM_172564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026534 predicted 1824
2 SASI_Hs01_00026535 predicted 1178
3 SASI_Hs01_00026536 predicted 1475
4 SASI_Hs01_00026537 predicted 1673
5 SASI_Hs01_00026538 predicted 1494
6 SASI_Hs01_00026540 predicted 579
7 SASI_Hs01_00026539 predicted 628
8 SASI_Hs02_00360473 predicted 2171
9 SASI_Hs01_00026543 predicted 1573
10 SASI_Hs02_00360474 predicted 567
11 SASI_Hs01_00026541 predicted 1678
12 SASI_Hs01_00026542 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061866 predicted 1431
2 SASI_Rn01_00061867 predicted 1452
3 SASI_Rn01_00061868 predicted 1933
4 SASI_Rn01_00061869 predicted 882
5 SASI_Rn02_00202764 predicted 2033
6 SASI_Rn01_00061870 predicted 944
7 SASI_Rn01_00061871 predicted 1160
8 SASI_Rn01_00061872 predicted 933
9 SASI_Rn01_00061873 predicted 382
10 SASI_Rn01_00061874 predicted 528
11 SASI_Rn01_00061875 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344208 predicted 1623
2 SASI_Mm02_00344209 predicted 2333
3 SASI_Mm02_00344210 predicted 1841
4 SASI_Mm02_00344211 predicted 1982
5 SASI_Mm02_00344212 predicted 2008
6 SASI_Mm02_00344213 predicted 576
7 SASI_Mm02_00344214 predicted 2238
8 SASI_Mm02_00344215 predicted 1625
9 SASI_Mm02_00344216 predicted 982
10 SASI_Mm02_00344217 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032865
VALIDATED
TNS4 MISSION shRNA Bacterial Glycerol Stock
tensin 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-1638s1c1
Sequence:CCGGCAATGACCTCATCCGACACTTCTCGAGAAGTGTCGGATGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032865.3-3272s1c1
Sequence:CCGGCCCAGCTTCTTTCCATTCCTTCTCGAGAAGGAATGGAAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-1022s1c1
Sequence:CCGGGCCATCAGTCATCTTCCAGATCTCGAGATCTGGAAGATGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2173s1c1
Sequence:CCGGGAGAACGTATGCCACCTCTTTCTCGAGAAAGAGGTGGCATACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2103s1c1
Sequence:CCGGGAAGTGGCAGAAGTACTGCAACTCGAGTTGCAGTACTTCTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032865.3-400s1c1
Sequence:CCGGGAGGACCTTGACTCCTACATTCTCGAGAATGTAGGAGTCAAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-405s1c1
Sequence:CCGGCCTTGACTCCTACATTGACTTCTCGAGAAGTCAATGTAGGAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-963s1c1
Sequence:CCGGGTCTGATGTCAGCTATATGTTCTCGAGAACATATAGCTGACATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-2465s1c1
Sequence:CCGGGCCTCAGTTTCCTCAATCATACTCGAGTATGATTGAGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-959s1c1
Sequence:CCGGCAGTGTCTGATGTCAGCTATACTCGAGTATAGCTGACATCAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032865
VALIDATED
TNS4 MISSION shRNA shRNA Plasmid DNA
tensin 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-1638s1c1
Sequence:CCGGCAATGACCTCATCCGACACTTCTCGAGAAGTGTCGGATGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032865.3-3272s1c1
Sequence:CCGGCCCAGCTTCTTTCCATTCCTTCTCGAGAAGGAATGGAAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-1022s1c1
Sequence:CCGGGCCATCAGTCATCTTCCAGATCTCGAGATCTGGAAGATGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2173s1c1
Sequence:CCGGGAGAACGTATGCCACCTCTTTCTCGAGAAAGAGGTGGCATACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2103s1c1
Sequence:CCGGGAAGTGGCAGAAGTACTGCAACTCGAGTTGCAGTACTTCTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032865.3-400s1c1
Sequence:CCGGGAGGACCTTGACTCCTACATTCTCGAGAATGTAGGAGTCAAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-405s1c1
Sequence:CCGGCCTTGACTCCTACATTGACTTCTCGAGAAGTCAATGTAGGAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-963s1c1
Sequence:CCGGGTCTGATGTCAGCTATATGTTCTCGAGAACATATAGCTGACATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-2465s1c1
Sequence:CCGGGCCTCAGTTTCCTCAATCATACTCGAGTATGATTGAGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-959s1c1
Sequence:CCGGCAGTGTCTGATGTCAGCTATACTCGAGTATAGCTGACATCAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032865
VALIDATED
TNS4 MISSION shRNA Lentiviral Transduction Particles
tensin 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-1638s1c1
Sequence:CCGGCAATGACCTCATCCGACACTTCTCGAGAAGTGTCGGATGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032865.3-3272s1c1
Sequence:CCGGCCCAGCTTCTTTCCATTCCTTCTCGAGAAGGAATGGAAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-1022s1c1
Sequence:CCGGGCCATCAGTCATCTTCCAGATCTCGAGATCTGGAAGATGACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2173s1c1
Sequence:CCGGGAGAACGTATGCCACCTCTTTCTCGAGAAAGAGGTGGCATACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-2103s1c1
Sequence:CCGGGAAGTGGCAGAAGTACTGCAACTCGAGTTGCAGTACTTCTGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032865.3-400s1c1
Sequence:CCGGGAGGACCTTGACTCCTACATTCTCGAGAATGTAGGAGTCAAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-405s1c1
Sequence:CCGGCCTTGACTCCTACATTGACTTCTCGAGAAGTCAATGTAGGAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-963s1c1
Sequence:CCGGGTCTGATGTCAGCTATATGTTCTCGAGAACATATAGCTGACATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032865.3-2465s1c1
Sequence:CCGGGCCTCAGTTTCCTCAATCATACTCGAGTATGATTGAGGAAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032865.3-959s1c1
Sequence:CCGGCAGTGTCTGATGTCAGCTATACTCGAGTATAGCTGACATCAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172564
TNS4 MISSION shRNA Bacterial Glycerol Stock
tensin 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000121427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172564.1-3974s1c1
Sequence:CCGGCCCATTACAAATGAACATCATCTCGAGATGATGTTCATTTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-539s1c1
Sequence:CCGGCAACAGTATCATGTCAAGGAACTCGAGTTCCTTGACATGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-575s1c1
Sequence:CCGGCGAAGCCTTAGATATAAAGTACTCGAGTACTTTATATCTAAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-1428s1c1
Sequence:CCGGGACACATCAAAGTATTGGTTTCTCGAGAAACCAATACTTTGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172564
TNS4 MISSION shRNA shRNA Plasmid DNA
tensin 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000121427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172564.1-3974s1c1
Sequence:CCGGCCCATTACAAATGAACATCATCTCGAGATGATGTTCATTTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-539s1c1
Sequence:CCGGCAACAGTATCATGTCAAGGAACTCGAGTTCCTTGACATGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-575s1c1
Sequence:CCGGCGAAGCCTTAGATATAAAGTACTCGAGTACTTTATATCTAAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-1428s1c1
Sequence:CCGGGACACATCAAAGTATTGGTTTCTCGAGAAACCAATACTTTGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172564
TNS4 MISSION shRNA Lentiviral Transduction Particles
tensin 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000121427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172564.1-3974s1c1
Sequence:CCGGCCCATTACAAATGAACATCATCTCGAGATGATGTTCATTTGTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-539s1c1
Sequence:CCGGCAACAGTATCATGTCAAGGAACTCGAGTTCCTTGACATGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-575s1c1
Sequence:CCGGCGAAGCCTTAGATATAAAGTACTCGAGTACTTTATATCTAAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172564.1-1428s1c1
Sequence:CCGGGACACATCAAAGTATTGGTTTCTCGAGAAACCAATACTTTGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks