EMAIL THIS PAGE TO A FRIEND

TNXB

tenascin XB

Synonyms: EDS3 HXBL TENX TN-X TNX TNXB1 TNXB2 TNXBS XB XBS
Gene ID:
Human(7148) Summary: This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(81877) tenascin XB
Rat(415089) tenascin XB
cow(282654) tenascin XB
sheep(100820740) tenascin XB
chicken(396106) tenascin XB
dog(100682877) tenascin XB
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019105 Rosetta Predictions human pricing
NM_032470 Rosetta Predictions human pricing
NM_031176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352728 predicted 11189
2 SASI_Hs01_00214131 predicted 12808
3 SASI_Hs01_00214132 predicted 12531
4 SASI_Hs01_00214133 predicted 11733
5 SASI_Hs02_00352729 predicted 11371
6 SASI_Hs01_00214134 predicted 11633
7 SASI_Hs01_00214137 predicted 12571
8 SASI_Hs01_00214138 predicted 12570
9 SASI_Hs01_00214140 predicted 12686
10 SASI_Hs02_00352730 predicted 11649
11 SASI_Hs01_00214135 predicted 12807
12 SASI_Hs01_00214136 predicted 12470
13 SASI_Hs01_00214139 predicted 12668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359922 predicted 1191
2 SASI_Hs01_00026494 predicted 2813
3 SASI_Hs01_00026495 predicted 2532
4 SASI_Hs01_00026496 predicted 1734
5 SASI_Hs02_00359923 predicted 1370
6 SASI_Hs01_00026497 predicted 1637
7 SASI_Hs01_00026498 predicted 2659
8 SASI_Hs01_00026500 predicted 2579
9 SASI_Hs01_00026501 predicted 2576
10 SASI_Hs01_00026503 predicted 2685
11 SASI_Hs01_00026499 predicted 2326
12 SASI_Hs01_00026502 predicted 2525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053870 predicted 6061
2 SASI_Mm01_00053871 predicted 6068
3 SASI_Mm01_00053872 predicted 943
4 SASI_Mm01_00053873 predicted 2564
5 SASI_Mm02_00337011 predicted 3327
6 SASI_Mm01_00053875 predicted 2457
7 SASI_Mm02_00337012 predicted 6462
8 SASI_Mm01_00053876 predicted 3615
9 SASI_Mm01_00053878 predicted 11622
10 SASI_Mm01_00053879 predicted 7249
11 SASI_Mm01_00053874 predicted 10894
12 SASI_Mm01_00053877 predicted 11717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031176
TNXB MISSION shRNA Bacterial Glycerol Stock
tenascin XB
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000110766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-76s1c1
Sequence:CCGGCCTCGGTCTAATGTGACACTTCTCGAGAAGTGTCACATTAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-9444s1c1
Sequence:CCGGCGACTCTTTCTTAGTCCAGTACTCGAGTACTGGACTAAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-7236s1c1
Sequence:CCGGCGAGGAACAGTTTGACCAATTCTCGAGAATTGGTCAAACTGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031176
TNXB MISSION shRNA shRNA Plasmid DNA
tenascin XB
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000110766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-76s1c1
Sequence:CCGGCCTCGGTCTAATGTGACACTTCTCGAGAAGTGTCACATTAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-9444s1c1
Sequence:CCGGCGACTCTTTCTTAGTCCAGTACTCGAGTACTGGACTAAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-7236s1c1
Sequence:CCGGCGAGGAACAGTTTGACCAATTCTCGAGAATTGGTCAAACTGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031176
TNXB MISSION shRNA Lentiviral Transduction Particles
tenascin XB
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000110766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-76s1c1
Sequence:CCGGCCTCGGTCTAATGTGACACTTCTCGAGAAGTGTCACATTAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-9444s1c1
Sequence:CCGGCGACTCTTTCTTAGTCCAGTACTCGAGTACTGGACTAAGAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031176.1-7236s1c1
Sequence:CCGGCGAGGAACAGTTTGACCAATTCTCGAGAATTGGTCAAACTGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019105
TNXB MISSION shRNA Bacterial Glycerol Stock
tenascin XB
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-4428s1c1
Sequence:CCGGCGACCGGAAGTATAAGATGAACTCGAGTTCATCTTATACTTCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-10581s1c1
Sequence:CCGGGCCCAGTAGGAAATACAGGTTCTCGAGAACCTGTATTTCCTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-9054s1c1
Sequence:CCGGGCCAGACCACAAGTACAAGATCTCGAGATCTTGTACTTGTGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-11617s1c1
Sequence:CCGGCGTGACCTCCAATTCAGTGAACTCGAGTTCACTGAATTGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-3589s1c1
Sequence:CCGGCCCATCATCTACCAAGGCATTCTCGAGAATGCCTTGGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-2893s21c1
Sequence:CCGGCCTGATGCCAGGCGTAGAATACTCGAGTATTCTACGCCTGGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-6333s21c1
Sequence:CCGGGCCTGGAGCCAGACCATAAATCTCGAGATTTATGGTCTGGCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-4947s21c1
Sequence:CCGGAGCTGACAGTGACGGATATAACTCGAGTTATATCCGTCACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019105
TNXB MISSION shRNA shRNA Plasmid DNA
tenascin XB
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-4428s1c1
Sequence:CCGGCGACCGGAAGTATAAGATGAACTCGAGTTCATCTTATACTTCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-10581s1c1
Sequence:CCGGGCCCAGTAGGAAATACAGGTTCTCGAGAACCTGTATTTCCTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-9054s1c1
Sequence:CCGGGCCAGACCACAAGTACAAGATCTCGAGATCTTGTACTTGTGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-11617s1c1
Sequence:CCGGCGTGACCTCCAATTCAGTGAACTCGAGTTCACTGAATTGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-3589s1c1
Sequence:CCGGCCCATCATCTACCAAGGCATTCTCGAGAATGCCTTGGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-2893s21c1
Sequence:CCGGCCTGATGCCAGGCGTAGAATACTCGAGTATTCTACGCCTGGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-6333s21c1
Sequence:CCGGGCCTGGAGCCAGACCATAAATCTCGAGATTTATGGTCTGGCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-4947s21c1
Sequence:CCGGAGCTGACAGTGACGGATATAACTCGAGTTATATCCGTCACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019105
TNXB MISSION shRNA Lentiviral Transduction Particles
tenascin XB
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-4428s1c1
Sequence:CCGGCGACCGGAAGTATAAGATGAACTCGAGTTCATCTTATACTTCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-10581s1c1
Sequence:CCGGGCCCAGTAGGAAATACAGGTTCTCGAGAACCTGTATTTCCTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-9054s1c1
Sequence:CCGGGCCAGACCACAAGTACAAGATCTCGAGATCTTGTACTTGTGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-11617s1c1
Sequence:CCGGCGTGACCTCCAATTCAGTGAACTCGAGTTCACTGAATTGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019105.4-3589s1c1
Sequence:CCGGCCCATCATCTACCAAGGCATTCTCGAGAATGCCTTGGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-2893s21c1
Sequence:CCGGCCTGATGCCAGGCGTAGAATACTCGAGTATTCTACGCCTGGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-6333s21c1
Sequence:CCGGGCCTGGAGCCAGACCATAAATCTCGAGATTTATGGTCTGGCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019105.6-4947s21c1
Sequence:CCGGAGCTGACAGTGACGGATATAACTCGAGTTATATCCGTCACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks