EMAIL THIS PAGE TO A FRIEND

TOB1

transducer of ERBB2, 1

Synonyms: APRO6 PIG49 TOB TROB TROB1
UniProtKB ID: P50616, B2R9T0, D3DTY3, Q4KMQ0
Gene ID:
Human(10140) Summary: This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(22057) transducer of ErbB-2.1
Rat(170842) transducer of ErbB-2.1
chicken(395225) transducer of ERBB2, 1
domestic cat(101098267) transducer of ERBB2, 1
Horse(100056451) transducer of ERBB2, 1
dog(100683517) transducer of ERBB2, 1
cow(768016) transducer of ERBB2, 1
cow(784737) transducer of ERBB2, 1
sheep(101103823) transducer of ERBB2, 1
naked mole-rat(101720365) transducer of ERBB2, 1
domestic guinea pig(100727297) transducer of ERBB2, 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005749 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005749 Rosetta Predictions human pricing
NM_133317 Rosetta Predictions rat pricing
NM_009427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340208 predicted 510
2 SASI_Hs01_00245092 predicted 315
3 SASI_Hs01_00245094 predicted 303
4 SASI_Hs02_00340209 predicted 215
5 SASI_Hs01_00245095 predicted 275
6 SASI_Hs01_00245096 predicted 230
7 SASI_Hs01_00245097 predicted 250
8 SASI_Hs01_00245098 predicted 281
9 SASI_Hs01_00245099 predicted 291
10 SASI_Hs01_00245100 predicted 394
11 SASI_Hs01_00245093 predicted 375
12 SASI_Hs01_00245101 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060626 predicted 305
2 SASI_Rn01_00060627 predicted 468
3 SASI_Rn01_00060628 predicted 426
4 SASI_Rn01_00060629 predicted 485
5 SASI_Rn01_00060630 predicted 345
6 SASI_Rn02_00267625 predicted 365
7 SASI_Rn01_00060631 predicted 478
8 SASI_Rn01_00060632 predicted 392
9 SASI_Rn01_00060634 predicted 371
10 SASI_Rn02_00267626 predicted 434
11 SASI_Rn01_00060625 predicted 507
12 SASI_Rn01_00060633 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095251 predicted 670
2 SASI_Mm01_00095252 predicted 786
3 SASI_Mm01_00095253 predicted 648
4 SASI_Mm01_00095254 predicted 685
5 SASI_Mm01_00095255 predicted 716
6 SASI_Mm01_00095256 predicted 753
7 SASI_Mm01_00095257 predicted 641
8 SASI_Mm01_00095258 predicted 761
9 SASI_Mm01_00095259 predicted 668
10 SASI_Mm01_00095260 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005749
VALIDATED
TOB1 MISSION shRNA Bacterial Glycerol Stock
transducer of ERBB2, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-353s21c1
Sequence:CCGGGGGACCAGTGAAGGTGCTTTACTCGAGTAAAGCACCTTCACTGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-1031s21c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-839s21c1
Sequence:CCGGTCCTAATGCCAAGGAATTTATCTCGAGATAAATTCCTTGGCATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-97s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005749.2-1442s21c1
Sequence:CCGGCTACGACATGGTATTGCATTTCTCGAGAAATGCAATACCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005749.2-1537s1c1
Sequence:CCGGCCATCTTAAAGACATCAACTACTCGAGTAGTTGATGTCTTTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-628s1c1
Sequence:CCGGGCAACAAGGTTGCACGTACTTCTCGAGAAGTACGTGCAACCTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005749.2-317s1c1
Sequence:CCGGCGACCCATTTGAGGTTTCTTACTCGAGTAAGAAACCTCAAATGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1052s1c1
Sequence:CCGGCCAGCCTGTTATGGCTAACTACTCGAGTAGTTAGCCATAACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1031s1c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005749
VALIDATED
TOB1 MISSION shRNA shRNA Plasmid DNA
transducer of ERBB2, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-353s21c1
Sequence:CCGGGGGACCAGTGAAGGTGCTTTACTCGAGTAAAGCACCTTCACTGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-1031s21c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-839s21c1
Sequence:CCGGTCCTAATGCCAAGGAATTTATCTCGAGATAAATTCCTTGGCATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-97s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005749.2-1442s21c1
Sequence:CCGGCTACGACATGGTATTGCATTTCTCGAGAAATGCAATACCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005749.2-1537s1c1
Sequence:CCGGCCATCTTAAAGACATCAACTACTCGAGTAGTTGATGTCTTTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-628s1c1
Sequence:CCGGGCAACAAGGTTGCACGTACTTCTCGAGAAGTACGTGCAACCTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005749.2-317s1c1
Sequence:CCGGCGACCCATTTGAGGTTTCTTACTCGAGTAAGAAACCTCAAATGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1052s1c1
Sequence:CCGGCCAGCCTGTTATGGCTAACTACTCGAGTAGTTAGCCATAACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1031s1c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005749
VALIDATED
TOB1 MISSION shRNA Lentiviral Transduction Particles
transducer of ERBB2, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-353s21c1
Sequence:CCGGGGGACCAGTGAAGGTGCTTTACTCGAGTAAAGCACCTTCACTGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-1031s21c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-839s21c1
Sequence:CCGGTCCTAATGCCAAGGAATTTATCTCGAGATAAATTCCTTGGCATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005749.2-97s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005749.2-1442s21c1
Sequence:CCGGCTACGACATGGTATTGCATTTCTCGAGAAATGCAATACCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005749.2-1537s1c1
Sequence:CCGGCCATCTTAAAGACATCAACTACTCGAGTAGTTGATGTCTTTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-628s1c1
Sequence:CCGGGCAACAAGGTTGCACGTACTTCTCGAGAAGTACGTGCAACCTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005749.2-317s1c1
Sequence:CCGGCGACCCATTTGAGGTTTCTTACTCGAGTAAGAAACCTCAAATGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1052s1c1
Sequence:CCGGCCAGCCTGTTATGGCTAACTACTCGAGTAGTTAGCCATAACAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005749.2-1031s1c1
Sequence:CCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009427
VALIDATED
TOB1 MISSION shRNA Bacterial Glycerol Stock
transducer of ERBB2, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009427.2-1502s21c1
Sequence:CCGGAGCCTGTTATGGCTAACTAAACTCGAGTTTAGTTAGCCATAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1479s21c1
Sequence:GTACCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1288s21c1
Sequence:GTACCGGCCCAATGCCAAGGAATTTATTCTCGAGAATAAATTCCTTGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009427.2-1747s21c1
Sequence:GTACCGGGATATGGCCTCTTACAGTATTCTCGAGAATACTGTAAGAGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-494s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1815s1c1
Sequence:CCGGGCACTAATAAGTGGGTTTATTCTCGAGAATAAACCCACTTATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-577s1c1
Sequence:CCGGCCATACAAAGGCTCAGGGTTTCTCGAGAAACCCTGAGCCTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1329s1c1
Sequence:CCGGAGGTAGTAGTACCAATGGAATCTCGAGATTCCATTGGTACTACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-720s1c1
Sequence:CCGGGTTTGAGGTTTCCTACCAGATCTCGAGATCTGGTAGGAAACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-494s1c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009427
VALIDATED
TOB1 MISSION shRNA shRNA Plasmid DNA
transducer of ERBB2, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009427.2-1502s21c1
Sequence:CCGGAGCCTGTTATGGCTAACTAAACTCGAGTTTAGTTAGCCATAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1479s21c1
Sequence:GTACCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1288s21c1
Sequence:GTACCGGCCCAATGCCAAGGAATTTATTCTCGAGAATAAATTCCTTGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009427.2-1747s21c1
Sequence:GTACCGGGATATGGCCTCTTACAGTATTCTCGAGAATACTGTAAGAGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-494s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1815s1c1
Sequence:CCGGGCACTAATAAGTGGGTTTATTCTCGAGAATAAACCCACTTATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-577s1c1
Sequence:CCGGCCATACAAAGGCTCAGGGTTTCTCGAGAAACCCTGAGCCTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1329s1c1
Sequence:CCGGAGGTAGTAGTACCAATGGAATCTCGAGATTCCATTGGTACTACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-720s1c1
Sequence:CCGGGTTTGAGGTTTCCTACCAGATCTCGAGATCTGGTAGGAAACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-494s1c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009427
VALIDATED
TOB1 MISSION shRNA Lentiviral Transduction Particles
transducer of ERBB2, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009427.2-1502s21c1
Sequence:CCGGAGCCTGTTATGGCTAACTAAACTCGAGTTTAGTTAGCCATAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1479s21c1
Sequence:GTACCGGGCAGTATTCTAACCAGCAATTCTCGAGAATTGCTGGTTAGAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-1288s21c1
Sequence:GTACCGGCCCAATGCCAAGGAATTTATTCTCGAGAATAAATTCCTTGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009427.2-1747s21c1
Sequence:GTACCGGGATATGGCCTCTTACAGTATTCTCGAGAATACTGTAAGAGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009427.2-494s21c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1815s1c1
Sequence:CCGGGCACTAATAAGTGGGTTTATTCTCGAGAATAAACCCACTTATTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-577s1c1
Sequence:CCGGCCATACAAAGGCTCAGGGTTTCTCGAGAAACCCTGAGCCTTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-1329s1c1
Sequence:CCGGAGGTAGTAGTACCAATGGAATCTCGAGATTCCATTGGTACTACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-720s1c1
Sequence:CCGGGTTTGAGGTTTCCTACCAGATCTCGAGATCTGGTAGGAAACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009427.2-494s1c1
Sequence:CCGGCCAGGAGACGTGTCAACATTTCTCGAGAAATGTTGACACGTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks