EMAIL THIS PAGE TO A FRIEND

TOB2

transducer of ERBB2, 2

Synonyms: TOB4 TOBL TROB2
UniProtKB ID: Q14106, Q6FHR7, Q9BY97, Q9UBI0
Gene ID:
Human(10766) Summary: TOB2 belongs to the TOB (see TOB1; MIM 605523)/BTG1 (MIM 109580) family of antiproliferative proteins, which are involved in the regulation of cell cycle progression.[supplied by OMIM, Apr 2004]
Mouse(57259) transducer of ERBB2, 2
Rat(315159) transducer of ERBB2, 2
chicken(417992) transducer of ERBB2, 2
domestic cat(101100900) transducer of ERBB2, 2
dog(481233) transducer of ERBB2, 2
domestic guinea pig(100735653) transducer of ERBB2, 2
naked mole-rat(101706460) transducer of ERBB2, 2
cow(507934) transducer of ERBB2, 2
sheep(100620046) transducer of ERBB2, 2
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016272 Rosetta Predictions human pricing
NM_001007146 Rosetta Predictions rat pricing
NM_020507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022931 predicted 2221
2 SASI_Hs01_00022940 predicted 2217
3 SASI_Hs01_00022932 predicted 973
4 SASI_Hs01_00022933 predicted 987
5 SASI_Hs02_00349184 predicted 978
6 SASI_Hs02_00349185 predicted 1377
7 SASI_Hs01_00022935 predicted 1365
8 SASI_Hs01_00022937 predicted 1112
9 SASI_Hs01_00022938 predicted 2124
10 SASI_Hs02_00349186 predicted 1877
11 SASI_Hs01_00022934 predicted 1844
12 SASI_Hs01_00022936 predicted 1661
13 SASI_Hs01_00022939 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102469 predicted 1169
2 SASI_Rn01_00102471 predicted 1768
3 SASI_Rn01_00102472 predicted 658
4 SASI_Rn01_00102473 predicted 1157
5 SASI_Rn02_00198621 predicted 1017
6 SASI_Rn01_00102474 predicted 522
7 SASI_Rn01_00102475 predicted 252
8 SASI_Rn01_00102476 predicted 949
9 SASI_Rn01_00102477 predicted 632
10 SASI_Rn02_00198622 predicted 926
11 SASI_Rn01_00102468 predicted 921
12 SASI_Rn01_00102470 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142159 predicted 1038
2 SASI_Mm01_00142160 predicted 588
3 SASI_Mm01_00142162 predicted 908
4 SASI_Mm01_00142164 predicted 626
5 SASI_Mm01_00142165 predicted 633
6 SASI_Mm01_00142166 predicted 1183
7 SASI_Mm02_00325560 predicted 1038
8 SASI_Mm01_00142167 predicted 1525
9 SASI_Mm02_00325561 predicted 1196
10 SASI_Mm01_00142168 predicted 770
11 SASI_Mm01_00142161 predicted 1390
12 SASI_Mm01_00142163 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016272
TOB2 MISSION shRNA Bacterial Glycerol Stock
transducer of ERBB2, 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-638s1c1
Sequence:CCGGCTGGCTTCCGCTGTGTTCACACTCGAGTGTGAACACAGCGGAAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-745s1c1
Sequence:CCGGGAGCTGAGTGTCTGGATTGATCTCGAGATCAATCCAGACACTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016272.x-1723s1c1
Sequence:CCGGCGGCCTGTGATTTATTTGGTTCTCGAGAACCAAATAAATCACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-849s1c1
Sequence:CCGGAGAGCTGGACAAGGAGATCAACTCGAGTTGATCTCCTTGTCCAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1245s21c1
Sequence:CCGGTCCTTCGCTGCCACCAAATTTCTCGAGAAATTTGGTGGCAGCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1645s21c1
Sequence:CCGGTCCTGGAGAAGACACCCTTTGCTCGAGCAAAGGGTGTCTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1603s21c1
Sequence:CCGGTTGACATGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-997s21c1
Sequence:CCGGTTGAGGTGTCCTACCAGATTGCTCGAGCAATCTGGTAGGACACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016272.3-2641s21c1
Sequence:CCGGTGGGTCGCAAGTCCTTATTTACTCGAGTAAATAAGGACTTGCGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016272
TOB2 MISSION shRNA shRNA Plasmid DNA
transducer of ERBB2, 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-638s1c1
Sequence:CCGGCTGGCTTCCGCTGTGTTCACACTCGAGTGTGAACACAGCGGAAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-745s1c1
Sequence:CCGGGAGCTGAGTGTCTGGATTGATCTCGAGATCAATCCAGACACTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016272.x-1723s1c1
Sequence:CCGGCGGCCTGTGATTTATTTGGTTCTCGAGAACCAAATAAATCACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-849s1c1
Sequence:CCGGAGAGCTGGACAAGGAGATCAACTCGAGTTGATCTCCTTGTCCAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1245s21c1
Sequence:CCGGTCCTTCGCTGCCACCAAATTTCTCGAGAAATTTGGTGGCAGCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1645s21c1
Sequence:CCGGTCCTGGAGAAGACACCCTTTGCTCGAGCAAAGGGTGTCTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1603s21c1
Sequence:CCGGTTGACATGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-997s21c1
Sequence:CCGGTTGAGGTGTCCTACCAGATTGCTCGAGCAATCTGGTAGGACACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016272.3-2641s21c1
Sequence:CCGGTGGGTCGCAAGTCCTTATTTACTCGAGTAAATAAGGACTTGCGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016272
TOB2 MISSION shRNA Lentiviral Transduction Particles
transducer of ERBB2, 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-638s1c1
Sequence:CCGGCTGGCTTCCGCTGTGTTCACACTCGAGTGTGAACACAGCGGAAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-745s1c1
Sequence:CCGGGAGCTGAGTGTCTGGATTGATCTCGAGATCAATCCAGACACTCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016272.x-1723s1c1
Sequence:CCGGCGGCCTGTGATTTATTTGGTTCTCGAGAACCAAATAAATCACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016272.x-849s1c1
Sequence:CCGGAGAGCTGGACAAGGAGATCAACTCGAGTTGATCTCCTTGTCCAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1245s21c1
Sequence:CCGGTCCTTCGCTGCCACCAAATTTCTCGAGAAATTTGGTGGCAGCGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1645s21c1
Sequence:CCGGTCCTGGAGAAGACACCCTTTGCTCGAGCAAAGGGTGTCTTCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-1603s21c1
Sequence:CCGGTTGACATGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016272.3-997s21c1
Sequence:CCGGTTGAGGTGTCCTACCAGATTGCTCGAGCAATCTGGTAGGACACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016272.3-2641s21c1
Sequence:CCGGTGGGTCGCAAGTCCTTATTTACTCGAGTAAATAAGGACTTGCGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020507
VALIDATED
TOB2 MISSION shRNA Bacterial Glycerol Stock
transducer of ERBB2, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020507.2-2379s1c1
Sequence:CCGGGCACTGCATAAGAAACTGGTTCTCGAGAACCAGTTTCTTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-901s1c1
Sequence:CCGGCACCTTTACTACTGCCTCTTTCTCGAGAAAGAGGCAGTAGTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-476s1c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-412s1c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-1303s1c1
Sequence:CCGGCGGTGCTAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-530s21c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-594s21c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-787s21c1
Sequence:CCGGTCGAGGTATCCTACCAGATTGCTCGAGCAATCTGGTAGGATACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-1465s21c1
Sequence:CCGGGCCTCAGCTACAACCTGAATACTCGAGTATTCAGGTTGTAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020507.3-1728s21c1
Sequence:CCGGTATTCTGCCTGCCTCTGATTTCTCGAGAAATCAGAGGCAGGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020507
VALIDATED
TOB2 MISSION shRNA shRNA Plasmid DNA
transducer of ERBB2, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020507.2-2379s1c1
Sequence:CCGGGCACTGCATAAGAAACTGGTTCTCGAGAACCAGTTTCTTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-901s1c1
Sequence:CCGGCACCTTTACTACTGCCTCTTTCTCGAGAAAGAGGCAGTAGTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-476s1c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-412s1c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-1303s1c1
Sequence:CCGGCGGTGCTAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-530s21c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-594s21c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-787s21c1
Sequence:CCGGTCGAGGTATCCTACCAGATTGCTCGAGCAATCTGGTAGGATACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-1465s21c1
Sequence:CCGGGCCTCAGCTACAACCTGAATACTCGAGTATTCAGGTTGTAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020507.3-1728s21c1
Sequence:CCGGTATTCTGCCTGCCTCTGATTTCTCGAGAAATCAGAGGCAGGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020507
VALIDATED
TOB2 MISSION shRNA Lentiviral Transduction Particles
transducer of ERBB2, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020507.2-2379s1c1
Sequence:CCGGGCACTGCATAAGAAACTGGTTCTCGAGAACCAGTTTCTTATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-901s1c1
Sequence:CCGGCACCTTTACTACTGCCTCTTTCTCGAGAAAGAGGCAGTAGTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-476s1c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020507.2-412s1c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020507.2-1303s1c1
Sequence:CCGGCGGTGCTAACAGCCTGTTCTTCTCGAGAAGAACAGGCTGTTAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-530s21c1
Sequence:CCGGCATCATCTCCTACTTATACAACTCGAGTTGTATAAGTAGGAGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-594s21c1
Sequence:CCGGGAGCGGCTTCTGAGAAAGAAACTCGAGTTTCTTTCTCAGAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-787s21c1
Sequence:CCGGTCGAGGTATCCTACCAGATTGCTCGAGCAATCTGGTAGGATACCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020507.3-1465s21c1
Sequence:CCGGGCCTCAGCTACAACCTGAATACTCGAGTATTCAGGTTGTAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020507.3-1728s21c1
Sequence:CCGGTATTCTGCCTGCCTCTGATTTCTCGAGAAATCAGAGGCAGGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks