EMAIL THIS PAGE TO A FRIEND

TOE1

target of EGR1, member 1 (nuclear)

UniProtKB ID: Q96GM8, Q6IA35, Q8IWN5, Q9H846
Gene ID:
Mouse(68276) target of EGR1, member 1 (nuclear)
Rat(298443) target of EGR1, member 1 (nuclear)
Zebrafish(568260) target of EGR1, member 1 (nuclear)
domestic cat(101090706) target of EGR1, member 1 (nuclear)
Horse(100052538) target of EGR1, member 1 (nuclear)
dog(475377) target of EGR1, member 1 (nuclear)
chicken(424595) target of EGR1, member 1 (nuclear)
cow(513052) target of EGR1, member 1 (nuclear)
sheep(101119770) target of EGR1, member 1 (nuclear)
naked mole-rat(101709037) target of EGR1, member 1 (nuclear)
domestic guinea pig(100736163) target of EGR1, member 1 (nuclear)
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025077 Rosetta Predictions human pricing
NM_001106680 Rosetta Predictions rat pricing
NM_026654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141783 predicted 1156
2 SASI_Hs01_00141784 predicted 745
3 SASI_Hs02_00357756 predicted 1987
4 SASI_Hs01_00141785 predicted 755
5 SASI_Hs01_00141786 predicted 1544
6 SASI_Hs01_00141787 predicted 1821
7 SASI_Hs02_00357757 predicted 2052
8 SASI_Hs01_00141788 predicted 831
9 SASI_Hs02_00357758 predicted 2003
10 SASI_Hs01_00141789 predicted 1537
11 SASI_Hs01_00141782 predicted 1240
12 SASI_Hs01_00141790 predicted 1480
13 SASI_Hs01_00141791 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221328 predicted 261
2 SASI_Rn02_00221329 predicted 751
3 SASI_Rn02_00221330 predicted 369
4 SASI_Rn02_00221331 predicted 529
5 SASI_Rn02_00221332 predicted 1080
6 SASI_Rn02_00221333 predicted 605
7 SASI_Rn02_00221334 predicted 609
8 SASI_Rn02_00221335 predicted 1088
9 SASI_Rn02_00221336 predicted 460
10 SASI_Rn02_00221337 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085441 predicted 412
2 SASI_Mm01_00085442 predicted 1450
3 SASI_Mm01_00085443 predicted 605
4 SASI_Mm01_00085444 predicted 992
5 SASI_Mm01_00085445 predicted 1000
6 SASI_Mm01_00085446 predicted 1583
7 SASI_Mm01_00085447 predicted 1057
8 SASI_Mm01_00085448 predicted 286
9 SASI_Mm01_00085449 predicted 1442
10 SASI_Mm01_00085450 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025077
TOE1 MISSION shRNA Bacterial Glycerol Stock
target of EGR1, member 1 (nuclear)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1994s21c1
Sequence:CCGGGAATGCCACAATAAGGTATATCTCGAGATATACCTTATTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1256s21c1
Sequence:CCGGGGCATTTATGACACCAAATATCTCGAGATATTTGGTGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025077.3-2158s21c1
Sequence:CCGGGGGTCTCTCTAGCCTGAAATGCTCGAGCATTTCAGGCTAGAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1145s21c1
Sequence:CCGGGTGCTACACAATGGCCTTATACTCGAGTATAAGGCCATTGTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1050s1c1
Sequence:CCGGCCTACCATAAGGGCAATGACACTCGAGTGTCATTGCCCTTATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-737s1c1
Sequence:CCGGCTAGCCATAAAGACAGCTAATCTCGAGATTAGCTGTCTTTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1907s1c1
Sequence:CCGGGATGCCTTTATGACAGGTTATCTCGAGATAACCTGTCATAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1546s1c1
Sequence:CCGGCCTTATCATTGACACTGATGACTCGAGTCATCAGTGTCAATGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-917s1c1
Sequence:CCGGGAACATTCCTATCTGGCTCAACTCGAGTTGAGCCAGATAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025077
TOE1 MISSION shRNA shRNA Plasmid DNA
target of EGR1, member 1 (nuclear)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1994s21c1
Sequence:CCGGGAATGCCACAATAAGGTATATCTCGAGATATACCTTATTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1256s21c1
Sequence:CCGGGGCATTTATGACACCAAATATCTCGAGATATTTGGTGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025077.3-2158s21c1
Sequence:CCGGGGGTCTCTCTAGCCTGAAATGCTCGAGCATTTCAGGCTAGAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1145s21c1
Sequence:CCGGGTGCTACACAATGGCCTTATACTCGAGTATAAGGCCATTGTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1050s1c1
Sequence:CCGGCCTACCATAAGGGCAATGACACTCGAGTGTCATTGCCCTTATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-737s1c1
Sequence:CCGGCTAGCCATAAAGACAGCTAATCTCGAGATTAGCTGTCTTTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1907s1c1
Sequence:CCGGGATGCCTTTATGACAGGTTATCTCGAGATAACCTGTCATAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1546s1c1
Sequence:CCGGCCTTATCATTGACACTGATGACTCGAGTCATCAGTGTCAATGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-917s1c1
Sequence:CCGGGAACATTCCTATCTGGCTCAACTCGAGTTGAGCCAGATAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025077
TOE1 MISSION shRNA Lentiviral Transduction Particles
target of EGR1, member 1 (nuclear)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1994s21c1
Sequence:CCGGGAATGCCACAATAAGGTATATCTCGAGATATACCTTATTGTGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1256s21c1
Sequence:CCGGGGCATTTATGACACCAAATATCTCGAGATATTTGGTGTCATAAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025077.3-2158s21c1
Sequence:CCGGGGGTCTCTCTAGCCTGAAATGCTCGAGCATTTCAGGCTAGAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025077.3-1145s21c1
Sequence:CCGGGTGCTACACAATGGCCTTATACTCGAGTATAAGGCCATTGTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1050s1c1
Sequence:CCGGCCTACCATAAGGGCAATGACACTCGAGTGTCATTGCCCTTATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-737s1c1
Sequence:CCGGCTAGCCATAAAGACAGCTAATCTCGAGATTAGCTGTCTTTATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1907s1c1
Sequence:CCGGGATGCCTTTATGACAGGTTATCTCGAGATAACCTGTCATAAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-1546s1c1
Sequence:CCGGCCTTATCATTGACACTGATGACTCGAGTCATCAGTGTCAATGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025077.2-917s1c1
Sequence:CCGGGAACATTCCTATCTGGCTCAACTCGAGTTGAGCCAGATAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026654
VALIDATED
TOE1 MISSION shRNA Bacterial Glycerol Stock
target of EGR1, member 1 (nuclear)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-420s1c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-628s1c1
Sequence:CCGGGGTGTTCCTGTACCAGAATTTCTCGAGAAATTCTGGTACAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-771s21c1
Sequence:CCGGTAGAATACGCTTTCCGGAAATCTCGAGATTTCCGGAAAGCGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-997s21c1
Sequence:CCGGACACGATATTGACCTTATAATCTCGAGATTATAAGGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1650s21c1
Sequence:CCGGAGTGGCTTGTGTTGGTCATTCCTCGAGGAATGACCAACACAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-1454s21c1
Sequence:CCGGGAATGTCACAACAAGGTATATCTCGAGATATACCTTGTTGTGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-420s21c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-629s21c1
Sequence:CCGGGTGTTCCTGTACCAGAATTTCCTCGAGGAAATTCTGGTACAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-1070s21c1
Sequence:CCGGGACAAACGGAAGAGGTCTTTACTCGAGTAAAGACCTCTTCCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-602s21c1
Sequence:CCGGGTGCTACATAATGGCCTTATACTCGAGTATAAGGCCATTATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1704s21c1
Sequence:CCGGACAAGTTCATGGTCTACATAGCTCGAGCTATGTAGACCATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-702s21c1
Sequence:CCGGTGTTCCCAGCAGGCATCTATGCTCGAGCATAGATGCCTGCTGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.1-359s1c1
Sequence:CCGGCAGCAACCAGATAAGGGTGAACTCGAGTTCACCCTTATCTGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026654
VALIDATED
TOE1 MISSION shRNA shRNA Plasmid DNA
target of EGR1, member 1 (nuclear)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-420s1c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-628s1c1
Sequence:CCGGGGTGTTCCTGTACCAGAATTTCTCGAGAAATTCTGGTACAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-771s21c1
Sequence:CCGGTAGAATACGCTTTCCGGAAATCTCGAGATTTCCGGAAAGCGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-997s21c1
Sequence:CCGGACACGATATTGACCTTATAATCTCGAGATTATAAGGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1650s21c1
Sequence:CCGGAGTGGCTTGTGTTGGTCATTCCTCGAGGAATGACCAACACAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-1454s21c1
Sequence:CCGGGAATGTCACAACAAGGTATATCTCGAGATATACCTTGTTGTGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-420s21c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-629s21c1
Sequence:CCGGGTGTTCCTGTACCAGAATTTCCTCGAGGAAATTCTGGTACAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-1070s21c1
Sequence:CCGGGACAAACGGAAGAGGTCTTTACTCGAGTAAAGACCTCTTCCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-602s21c1
Sequence:CCGGGTGCTACATAATGGCCTTATACTCGAGTATAAGGCCATTATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1704s21c1
Sequence:CCGGACAAGTTCATGGTCTACATAGCTCGAGCTATGTAGACCATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-702s21c1
Sequence:CCGGTGTTCCCAGCAGGCATCTATGCTCGAGCATAGATGCCTGCTGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.1-359s1c1
Sequence:CCGGCAGCAACCAGATAAGGGTGAACTCGAGTTCACCCTTATCTGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026654
VALIDATED
TOE1 MISSION shRNA Lentiviral Transduction Particles
target of EGR1, member 1 (nuclear)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-420s1c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.2-628s1c1
Sequence:CCGGGGTGTTCCTGTACCAGAATTTCTCGAGAAATTCTGGTACAGGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-771s21c1
Sequence:CCGGTAGAATACGCTTTCCGGAAATCTCGAGATTTCCGGAAAGCGTATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-997s21c1
Sequence:CCGGACACGATATTGACCTTATAATCTCGAGATTATAAGGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1650s21c1
Sequence:CCGGAGTGGCTTGTGTTGGTCATTCCTCGAGGAATGACCAACACAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-1454s21c1
Sequence:CCGGGAATGTCACAACAAGGTATATCTCGAGATATACCTTGTTGTGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026654.2-420s21c1
Sequence:CCGGGCATAGAGGAGTACGTTATAGCTCGAGCTATAACGTACTCCTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-629s21c1
Sequence:CCGGGTGTTCCTGTACCAGAATTTCCTCGAGGAAATTCTGGTACAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-1070s21c1
Sequence:CCGGGACAAACGGAAGAGGTCTTTACTCGAGTAAAGACCTCTTCCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-602s21c1
Sequence:CCGGGTGCTACATAATGGCCTTATACTCGAGTATAAGGCCATTATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026654.2-1704s21c1
Sequence:CCGGACAAGTTCATGGTCTACATAGCTCGAGCTATGTAGACCATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026654.2-702s21c1
Sequence:CCGGTGTTCCCAGCAGGCATCTATGCTCGAGCATAGATGCCTGCTGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026654.1-359s1c1
Sequence:CCGGCAGCAACCAGATAAGGGTGAACTCGAGTTCACCCTTATCTGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks