EMAIL THIS PAGE TO A FRIEND

TOLLIP

toll interacting protein

Synonyms: IL-1RAcPIP
UniProtKB ID: Q9H0E2, Q9H9E6, Q9UJ69
Gene ID:
Human(54472) Summary: This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. [provided by RefSeq, Aug 2011]
Mouse(54473) toll interacting protein
Rat(361677) toll interacting protein
Zebrafish(336876) toll interacting protein
chicken(423099) toll interacting protein
dog(483657) toll interacting protein
domestic cat(101095614) toll interacting protein
cow(539480) toll interacting protein
sheep(101106506) toll interacting protein
domestic guinea pig(100730994) toll interacting protein
naked mole-rat(101719608) toll interacting protein
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3741 Anti-TOLLIP (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
PRS3743 Anti-TOLLIP (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, western blot pricing
SAB1407548 Anti-TOLLIP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
SAB2102508 Anti-TOLLIP antibody produced in rabbit affinity isolated antibody bovine, human, mouse, guinea pig, horse, rabbit, zebrafish, rat
western blot pricing
HPA038621 Anti-TOLLIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA038622 Anti-TOLLIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunohistochemistry, western blot pricing
SAB2106291 Anti-TOLLIP antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rabbit, human
ELISA, western blot pricing
WH0054472M1 Monoclonal Anti-TOLLIP antibody produced in mouse clone 1A5-2A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019009 Rosetta Predictions human pricing
NM_001109668 Rosetta Predictions rat pricing
NM_023764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038643 predicted 1002
2 SASI_Hs01_00038644 predicted 591
3 SASI_Hs01_00038645 predicted 504
4 SASI_Hs01_00038646 predicted 597
5 SASI_Hs01_00038647 predicted 268
6 SASI_Hs01_00038648 predicted 400
7 SASI_Hs01_00038649 predicted 586
8 SASI_Hs02_00352537 predicted 1076
9 SASI_Hs01_00038650 predicted 1004
10 SASI_Hs01_00038651 predicted 1005
11 SASI_Hs01_00038652 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250542 predicted 370
2 SASI_Rn02_00250543 predicted 469
3 SASI_Rn02_00250544 predicted 680
4 SASI_Rn02_00250545 predicted 971
5 SASI_Rn02_00250546 predicted 1275
6 SASI_Rn02_00250547 predicted 357
7 SASI_Rn02_00250548 predicted 751
8 SASI_Rn02_00250549 predicted 941
9 SASI_Rn02_00250550 predicted 375
10 SASI_Rn02_00250551 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125679 predicted 882
2 SASI_Mm01_00125680 predicted 1386
3 SASI_Mm01_00125682 predicted 1375
4 SASI_Mm01_00125683 predicted 376
5 SASI_Mm02_00327340 predicted 1136
6 SASI_Mm01_00125684 predicted 429
7 SASI_Mm01_00125685 predicted 1177
8 SASI_Mm02_00327341 predicted 397
9 SASI_Mm01_00125687 predicted 1232
10 SASI_Mm01_00125688 predicted 1349
11 SASI_Mm01_00125681 predicted 595
12 SASI_Mm01_00125686 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023764
VALIDATED
TOLLIP MISSION shRNA Bacterial Glycerol Stock
toll interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-886s1c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-391s1c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-306s1c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-163s1c1
Sequence:CCGGCTCCGTATAACACCCACACAACTCGAGTTGTGTGGGTGTTATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-798s1c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-885s21c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-390s21c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-797s21c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-305s21c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023764
VALIDATED
TOLLIP MISSION shRNA shRNA Plasmid DNA
toll interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-886s1c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-391s1c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-306s1c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-163s1c1
Sequence:CCGGCTCCGTATAACACCCACACAACTCGAGTTGTGTGGGTGTTATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-798s1c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-885s21c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-390s21c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-797s21c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-305s21c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023764
VALIDATED
TOLLIP MISSION shRNA Lentiviral Transduction Particles
toll interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-886s1c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023764.2-391s1c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-306s1c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-163s1c1
Sequence:CCGGCTCCGTATAACACCCACACAACTCGAGTTGTGTGGGTGTTATACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023764.2-798s1c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-885s21c1
Sequence:CCGGGCCATCAATTCCTTGCTGCAACTCGAGTTGCAGCAAGGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-390s21c1
Sequence:CCGGCCTCGCTGGAACAAAGTCATTCTCGAGAATGACTTTGTTCCAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-797s21c1
Sequence:CCGGCCTCAAAGCTATCCAGGACATCTCGAGATGTCCTGGATAGCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023764.3-305s21c1
Sequence:CCGGCATGACTCGTATGGACCCTTACTCGAGTAAGGGTCCATACGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019009
VALIDATED
TOLLIP MISSION shRNA Bacterial Glycerol Stock
toll interacting protein
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-813s1c1
Sequence:CCGGGAAAGCCATCCAGGACATGTTCTCGAGAACATGTCCTGGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-271s1c1
Sequence:CCGGCGACTGAACATCACGGTGGTACTCGAGTACCACCGTGATGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-407s1c1
Sequence:CCGGGCTGGAATAAGGTCATCCACTCTCGAGAGTGGATGACCTTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-444s1c1
Sequence:CCGGCGTGGACTCTTTCTATCTCGACTCGAGTCGAGATAGAAAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019009.2-2585s1c1
Sequence:CCGGCCGTGATATTAACAACTCTAACTCGAGTTAGAGTTGTTAATATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-484s21c1
Sequence:CCGGTTCTCCATGGACGACCGCATTCTCGAGAATGCGGTCGTCCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-1010s21c1
Sequence:CCGGCCAACAAGATTCCCGTGAAAGCTCGAGCTTTCACGGGAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-885s21c1
Sequence:CCGGGAACAAGGATGCCGCCATCAACTCGAGTTGATGGCGGCATCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-383s21c1
Sequence:CCGGCACACAATGGCGCCAAGAATCCTCGAGGATTCTTGGCGCCATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-294s21c1
Sequence:CCGGGGCAAAGTTGGCCAAGAATTACTCGAGTAATTCTTGGCCAACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-590s21c1
Sequence:CCGGACGACAAGGAGGGCATGATCACTCGAGTGATCATGCCCTCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-461s21c1
Sequence:CCGGTCGAGATCTTCGATGAGAGAGCTCGAGCTCTCTCATCGAAGATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-669s21c1
Sequence:CCGGGGTCCTGATGCCAACAGTGTACTCGAGTACACTGTTGGCATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-405s21c1
Sequence:CCGGCCGCTGGAATAAGGTCATCCACTCGAGTGGATGACCTTATTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019009
VALIDATED
TOLLIP MISSION shRNA shRNA Plasmid DNA
toll interacting protein
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-813s1c1
Sequence:CCGGGAAAGCCATCCAGGACATGTTCTCGAGAACATGTCCTGGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-271s1c1
Sequence:CCGGCGACTGAACATCACGGTGGTACTCGAGTACCACCGTGATGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-407s1c1
Sequence:CCGGGCTGGAATAAGGTCATCCACTCTCGAGAGTGGATGACCTTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-444s1c1
Sequence:CCGGCGTGGACTCTTTCTATCTCGACTCGAGTCGAGATAGAAAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019009.2-2585s1c1
Sequence:CCGGCCGTGATATTAACAACTCTAACTCGAGTTAGAGTTGTTAATATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-484s21c1
Sequence:CCGGTTCTCCATGGACGACCGCATTCTCGAGAATGCGGTCGTCCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-1010s21c1
Sequence:CCGGCCAACAAGATTCCCGTGAAAGCTCGAGCTTTCACGGGAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-885s21c1
Sequence:CCGGGAACAAGGATGCCGCCATCAACTCGAGTTGATGGCGGCATCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-383s21c1
Sequence:CCGGCACACAATGGCGCCAAGAATCCTCGAGGATTCTTGGCGCCATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-294s21c1
Sequence:CCGGGGCAAAGTTGGCCAAGAATTACTCGAGTAATTCTTGGCCAACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-590s21c1
Sequence:CCGGACGACAAGGAGGGCATGATCACTCGAGTGATCATGCCCTCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-461s21c1
Sequence:CCGGTCGAGATCTTCGATGAGAGAGCTCGAGCTCTCTCATCGAAGATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-669s21c1
Sequence:CCGGGGTCCTGATGCCAACAGTGTACTCGAGTACACTGTTGGCATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-405s21c1
Sequence:CCGGCCGCTGGAATAAGGTCATCCACTCGAGTGGATGACCTTATTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019009
VALIDATED
TOLLIP MISSION shRNA Lentiviral Transduction Particles
toll interacting protein
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-813s1c1
Sequence:CCGGGAAAGCCATCCAGGACATGTTCTCGAGAACATGTCCTGGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-271s1c1
Sequence:CCGGCGACTGAACATCACGGTGGTACTCGAGTACCACCGTGATGTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-407s1c1
Sequence:CCGGGCTGGAATAAGGTCATCCACTCTCGAGAGTGGATGACCTTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019009.2-444s1c1
Sequence:CCGGCGTGGACTCTTTCTATCTCGACTCGAGTCGAGATAGAAAGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019009.2-2585s1c1
Sequence:CCGGCCGTGATATTAACAACTCTAACTCGAGTTAGAGTTGTTAATATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-484s21c1
Sequence:CCGGTTCTCCATGGACGACCGCATTCTCGAGAATGCGGTCGTCCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-1010s21c1
Sequence:CCGGCCAACAAGATTCCCGTGAAAGCTCGAGCTTTCACGGGAATCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-885s21c1
Sequence:CCGGGAACAAGGATGCCGCCATCAACTCGAGTTGATGGCGGCATCCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-383s21c1
Sequence:CCGGCACACAATGGCGCCAAGAATCCTCGAGGATTCTTGGCGCCATTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-294s21c1
Sequence:CCGGGGCAAAGTTGGCCAAGAATTACTCGAGTAATTCTTGGCCAACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-590s21c1
Sequence:CCGGACGACAAGGAGGGCATGATCACTCGAGTGATCATGCCCTCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-461s21c1
Sequence:CCGGTCGAGATCTTCGATGAGAGAGCTCGAGCTCTCTCATCGAAGATCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019009.2-669s21c1
Sequence:CCGGGGTCCTGATGCCAACAGTGTACTCGAGTACACTGTTGGCATCAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019009.2-405s21c1
Sequence:CCGGCCGCTGGAATAAGGTCATCCACTCGAGTGGATGACCTTATTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks