EMAIL THIS PAGE TO A FRIEND

TOM1

target of myb1 (chicken)

UniProtKB ID: O60784, B4DEL9, B4DNA1, Q5TIJ6, Q86X74
Gene ID:
Human(10043) Summary: This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(21968) target of myb1 homolog (chicken)
Rat(361370) target of myb1 (chicken)
Thale Cress(828267) tobamovirus multiplication protein 1
chicken(396049) target of myb1
domestic cat(101092199) target of myb1 (chicken)
Horse(100054292) target of myb1 (chicken)
dog(608746) target of myb1 (chicken)
Zebrafish(403083) target of myb1-like
Zebrafish(553244) target of myb1 (chicken)
cow(504912) target of myb1 (chicken)
sheep(101120652) target of myb1 (chicken)
naked mole-rat(101709469) target of myb1 (chicken)
Domestic Rabbit(100351738) target of myb1 (chicken)
domestic guinea pig(100715187) target of myb1 (chicken)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143691 MISSION® esiRNA esiRNA human TOM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005488 Rosetta Predictions human pricing
NM_001008365 Rosetta Predictions rat pricing
NM_011622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014573 predicted 383
2 SASI_Hs02_00339680 predicted 1182
3 SASI_Hs01_00014574 predicted 1402
4 SASI_Hs01_00014577 predicted 1015
5 SASI_Hs02_00339681 predicted 1063
6 SASI_Hs01_00014578 predicted 742
7 SASI_Hs01_00014579 predicted 275
8 SASI_Hs02_00339682 predicted 266
9 SASI_Hs01_00014581 predicted 547
10 SASI_Hs02_00339683 predicted 1415
11 SASI_Hs01_00014575 predicted 584
12 SASI_Hs01_00014576 predicted 925
13 SASI_Hs01_00014580 predicted 262
14 SASI_Hs01_00014582 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199134 predicted 522
2 SASI_Rn01_00102681 predicted 1841
3 SASI_Rn01_00102682 predicted 1920
4 SASI_Rn01_00102683 predicted 467
5 SASI_Rn01_00102684 predicted 897
6 SASI_Rn01_00102685 predicted 1266
7 SASI_Rn01_00102686 predicted 1968
8 SASI_Rn01_00102687 predicted 1694
9 SASI_Rn01_00102688 predicted 375
10 SASI_Rn01_00102689 predicted 1740
11 SASI_Rn01_00102690 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165270 predicted 1056
2 SASI_Mm01_00165272 predicted 1069
3 SASI_Mm01_00165273 predicted 507
4 SASI_Mm02_00321064 predicted 877
5 SASI_Mm01_00165274 predicted 984
6 SASI_Mm01_00165275 predicted 1079
7 SASI_Mm01_00165276 predicted 1021
8 SASI_Mm01_00165277 predicted 1002
9 SASI_Mm01_00165278 predicted 1519
10 SASI_Mm01_00165279 predicted 1411
11 SASI_Mm01_00165271 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005488
VALIDATED
TOM1 MISSION shRNA Bacterial Glycerol Stock
target of myb1 (chicken)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-937s21c1
Sequence:GTACCGGTCATCCCTCAGATCGCCAATGCTCGAGCATTGGCGATCTGAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-646s21c1
Sequence:GTACCGGCACAATCAGGACAGGATTCTGCTCGAGCAGAATCCTGTCCTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-269s21c1
Sequence:GTACCGGAGATGCCCTCCGAGCAGTAAACTCGAGTTTACTGCTCGGAGGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-1012s21c1
Sequence:GTACCGGTGCGCCATGAACGGTTTGAACCTCGAGGTTCAAACCGTTCATGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-970s21c1
Sequence:GTACCGGAGGAGCTGCTCATCGTCAATGCTCGAGCATTGACGATGAGCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-332s21c1
Sequence:GTACCGGGGCTCTCACAGTCTTAGAAACCTCGAGGTTTCTAAGACTGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1377s1c1
Sequence:CCGGCCAGCGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1503s1c1
Sequence:CCGGCCCAGGAGAAAGATGATGACACTCGAGTGTCATCATCTTTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-919s1c1
Sequence:CCGGCGTCAATGACAATCTCAACAACTCGAGTTGTTGAGATTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-389s1c1
Sequence:CCGGCCCACCATCGTGCATGACAAACTCGAGTTTGTCATGCACGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-277s1c1
Sequence:CCGGAGTCTTAGAAACCTGTGTCAACTCGAGTTGACACAGGTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005488
VALIDATED
TOM1 MISSION shRNA shRNA Plasmid DNA
target of myb1 (chicken)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-937s21c1
Sequence:GTACCGGTCATCCCTCAGATCGCCAATGCTCGAGCATTGGCGATCTGAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-646s21c1
Sequence:GTACCGGCACAATCAGGACAGGATTCTGCTCGAGCAGAATCCTGTCCTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-269s21c1
Sequence:GTACCGGAGATGCCCTCCGAGCAGTAAACTCGAGTTTACTGCTCGGAGGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-1012s21c1
Sequence:GTACCGGTGCGCCATGAACGGTTTGAACCTCGAGGTTCAAACCGTTCATGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-970s21c1
Sequence:GTACCGGAGGAGCTGCTCATCGTCAATGCTCGAGCATTGACGATGAGCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-332s21c1
Sequence:GTACCGGGGCTCTCACAGTCTTAGAAACCTCGAGGTTTCTAAGACTGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1377s1c1
Sequence:CCGGCCAGCGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1503s1c1
Sequence:CCGGCCCAGGAGAAAGATGATGACACTCGAGTGTCATCATCTTTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-919s1c1
Sequence:CCGGCGTCAATGACAATCTCAACAACTCGAGTTGTTGAGATTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-389s1c1
Sequence:CCGGCCCACCATCGTGCATGACAAACTCGAGTTTGTCATGCACGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-277s1c1
Sequence:CCGGAGTCTTAGAAACCTGTGTCAACTCGAGTTGACACAGGTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005488
VALIDATED
TOM1 MISSION shRNA Lentiviral Transduction Particles
target of myb1 (chicken)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-937s21c1
Sequence:GTACCGGTCATCCCTCAGATCGCCAATGCTCGAGCATTGGCGATCTGAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-646s21c1
Sequence:GTACCGGCACAATCAGGACAGGATTCTGCTCGAGCAGAATCCTGTCCTGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-269s21c1
Sequence:GTACCGGAGATGCCCTCCGAGCAGTAAACTCGAGTTTACTGCTCGGAGGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-1012s21c1
Sequence:GTACCGGTGCGCCATGAACGGTTTGAACCTCGAGGTTCAAACCGTTCATGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-970s21c1
Sequence:GTACCGGAGGAGCTGCTCATCGTCAATGCTCGAGCATTGACGATGAGCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005488.2-332s21c1
Sequence:GTACCGGGGCTCTCACAGTCTTAGAAACCTCGAGGTTTCTAAGACTGTGAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1377s1c1
Sequence:CCGGCCAGCGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-1503s1c1
Sequence:CCGGCCCAGGAGAAAGATGATGACACTCGAGTGTCATCATCTTTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-919s1c1
Sequence:CCGGCGTCAATGACAATCTCAACAACTCGAGTTGTTGAGATTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-389s1c1
Sequence:CCGGCCCACCATCGTGCATGACAAACTCGAGTTTGTCATGCACGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005488.1-277s1c1
Sequence:CCGGAGTCTTAGAAACCTGTGTCAACTCGAGTTGACACAGGTTTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011622
VALIDATED
TOM1 MISSION shRNA Bacterial Glycerol Stock
target of myb1 (chicken)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-956s21c1
Sequence:GTACCGGACAACCTCAACAACGTGTTTCCTCGAGGAAACACGTTGTTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1915s21c1
Sequence:GTACCGGCACTAACAGTCTAGGCAATAGCTCGAGCTATTGCCTAGACTGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1765s21c1
Sequence:GTACCGGCCCATCCTGCTAACGACTATGCTCGAGCATAGTCGTTAGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-246s21c1
Sequence:GTACCGGAGCAGTGAAGAAGCGAATTATCTCGAGATAATTCGCTTCTTCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-1792s1c1
Sequence:CCGGGCTGACCTGATAGGACCTAATCTCGAGATTAGGTCCTATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1383s1c1
Sequence:CCGGCCAGTGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-221s1c1
Sequence:CCGGCGAGCAGTGAAGAAGCGAATTCTCGAGAATTCGCTTCTTCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-113s1c1
Sequence:CCGGCGGATCGAGAAAGCTACAGATCTCGAGATCTGTAGCTTTCTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1307s1c1
Sequence:CCGGGCCCGCATCATGGAGGACATTCTCGAGAATGTCCTCCATGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011622
VALIDATED
TOM1 MISSION shRNA shRNA Plasmid DNA
target of myb1 (chicken)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-956s21c1
Sequence:GTACCGGACAACCTCAACAACGTGTTTCCTCGAGGAAACACGTTGTTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1915s21c1
Sequence:GTACCGGCACTAACAGTCTAGGCAATAGCTCGAGCTATTGCCTAGACTGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1765s21c1
Sequence:GTACCGGCCCATCCTGCTAACGACTATGCTCGAGCATAGTCGTTAGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-246s21c1
Sequence:GTACCGGAGCAGTGAAGAAGCGAATTATCTCGAGATAATTCGCTTCTTCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-1792s1c1
Sequence:CCGGGCTGACCTGATAGGACCTAATCTCGAGATTAGGTCCTATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1383s1c1
Sequence:CCGGCCAGTGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-221s1c1
Sequence:CCGGCGAGCAGTGAAGAAGCGAATTCTCGAGAATTCGCTTCTTCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-113s1c1
Sequence:CCGGCGGATCGAGAAAGCTACAGATCTCGAGATCTGTAGCTTTCTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1307s1c1
Sequence:CCGGGCCCGCATCATGGAGGACATTCTCGAGAATGTCCTCCATGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011622
VALIDATED
TOM1 MISSION shRNA Lentiviral Transduction Particles
target of myb1 (chicken)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-956s21c1
Sequence:GTACCGGACAACCTCAACAACGTGTTTCCTCGAGGAAACACGTTGTTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1915s21c1
Sequence:GTACCGGCACTAACAGTCTAGGCAATAGCTCGAGCTATTGCCTAGACTGTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011622.3-1765s21c1
Sequence:GTACCGGCCCATCCTGCTAACGACTATGCTCGAGCATAGTCGTTAGCAGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011622.3-246s21c1
Sequence:GTACCGGAGCAGTGAAGAAGCGAATTATCTCGAGATAATTCGCTTCTTCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-1792s1c1
Sequence:CCGGGCTGACCTGATAGGACCTAATCTCGAGATTAGGTCCTATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1383s1c1
Sequence:CCGGCCAGTGAAGAATTTGACAAATCTCGAGATTTGTCAAATTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011622.1-221s1c1
Sequence:CCGGCGAGCAGTGAAGAAGCGAATTCTCGAGAATTCGCTTCTTCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-113s1c1
Sequence:CCGGCGGATCGAGAAAGCTACAGATCTCGAGATCTGTAGCTTTCTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011622.1-1307s1c1
Sequence:CCGGGCCCGCATCATGGAGGACATTCTCGAGAATGTCCTCCATGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks