EMAIL THIS PAGE TO A FRIEND

TOM1L1

target of myb1 (chicken)-like 1

Synonyms: OK/KNS-CL.3 SRCASM
UniProtKB ID: O75674, Q53G06
Gene ID:
Mouse(71943) target of myb1-like 1 (chicken)
Rat(287622) target of myb1 (chicken)-like 1
domestic guinea pig(100735540) target of myb1 (chicken)-like 1
Domestic Rabbit(100344255) target of myb1 (chicken)-like 1
naked mole-rat(101700965) target of myb1 (chicken)-like 1
cow(513303) target of myb1 (chicken)-like 1
sheep(101120591) target of myb1 (chicken)-like 1
chicken(417391) target of myb1-like 1
Horse(100070513) target of myb1 (chicken)-like 1
domestic cat(101086356) target of myb1 (chicken)-like 1
dog(491093) target of myb1 (chicken)-like 1
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005486 Rosetta Predictions human pricing
XM_220861 Rosetta Predictions rat pricing
XR_009456 Rosetta Predictions rat pricing
NM_028011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339676 predicted 672
2 SASI_Hs01_00062035 predicted 811
3 SASI_Hs02_00339677 predicted 1246
4 SASI_Hs01_00062036 predicted 965
5 SASI_Hs01_00062037 predicted 805
6 SASI_Hs01_00062038 predicted 517
7 SASI_Hs01_00062040 predicted 1389
8 SASI_Hs01_00062041 predicted 245
9 SASI_Hs01_00062042 predicted 1227
10 SASI_Hs01_00062044 predicted 1353
11 SASI_Hs01_00062039 predicted 1044
12 SASI_Hs01_00062043 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131668 predicted 2380
2 SASI_Rn01_00131669 predicted 2404
3 SASI_Rn01_00131670 predicted 2305
4 SASI_Rn01_00131671 predicted 1187
5 SASI_Rn01_00131672 predicted 1212
6 SASI_Rn01_00131673 predicted 2367
7 SASI_Rn01_00131674 predicted 2319
8 SASI_Rn01_00131675 predicted 1196
9 SASI_Rn01_00131676 predicted 2043
10 SASI_Rn01_00131677 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122755 predicted 776
2 SASI_Rn01_00122756 predicted 1410
3 SASI_Rn02_00419779 predicted 248
4 SASI_Rn01_00122757 predicted 703
5 SASI_Rn02_00419780 predicted 1061
6 SASI_Rn01_00122758 predicted 910
7 SASI_Rn01_00122759 predicted 923
8 SASI_Rn01_00122760 predicted 1359
9 SASI_Rn01_00122761 predicted 915
10 SASI_Rn01_00122762 predicted 1759
11 SASI_Rn01_00122754 predicted 238
12 SASI_Rn01_00122763 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333117 predicted 837
2 SASI_Mm02_00333118 predicted 441
3 SASI_Mm02_00333119 predicted 1358
4 SASI_Mm02_00333120 predicted 1096
5 SASI_Mm02_00333121 predicted 1368
6 SASI_Mm02_00333122 predicted 1093
7 SASI_Mm02_00333123 predicted 835
8 SASI_Mm02_00333124 predicted 1133
9 SASI_Mm02_00333125 predicted 700
10 SASI_Mm02_00333126 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005486
VALIDATED
TOM1L1 MISSION shRNA Bacterial Glycerol Stock
target of myb1 (chicken)-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-595s1c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-349s1c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1135s1c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-237s1c1
Sequence:CCGGCCAACTTACCTTGTCACTTATCTCGAGATAAGTGACAAGGTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1246s1c1
Sequence:CCGGCCAGTTAGTCTACAAACCATTCTCGAGAATGGTTTGTAGACTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-494s21c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1477s21c1
Sequence:CCGGTGATCTCCAGCCACCTAATTACTCGAGTAATTAGGTGGCTGGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-740s21c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1280s21c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-823s21c1
Sequence:CCGGGCGAGTGATGTCCGCCATATTCTCGAGAATATGGCGGACATCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005486
VALIDATED
TOM1L1 MISSION shRNA shRNA Plasmid DNA
target of myb1 (chicken)-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-595s1c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-349s1c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1135s1c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-237s1c1
Sequence:CCGGCCAACTTACCTTGTCACTTATCTCGAGATAAGTGACAAGGTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1246s1c1
Sequence:CCGGCCAGTTAGTCTACAAACCATTCTCGAGAATGGTTTGTAGACTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-494s21c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1477s21c1
Sequence:CCGGTGATCTCCAGCCACCTAATTACTCGAGTAATTAGGTGGCTGGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-740s21c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1280s21c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-823s21c1
Sequence:CCGGGCGAGTGATGTCCGCCATATTCTCGAGAATATGGCGGACATCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005486
VALIDATED
TOM1L1 MISSION shRNA Lentiviral Transduction Particles
target of myb1 (chicken)-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-595s1c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-349s1c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1135s1c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-237s1c1
Sequence:CCGGCCAACTTACCTTGTCACTTATCTCGAGATAAGTGACAAGGTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005486.1-1246s1c1
Sequence:CCGGCCAGTTAGTCTACAAACCATTCTCGAGAATGGTTTGTAGACTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-494s21c1
Sequence:CCGGCCCAGATACAACTTGCCATTACTCGAGTAATGGCAAGTTGTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1477s21c1
Sequence:CCGGTGATCTCCAGCCACCTAATTACTCGAGTAATTAGGTGGCTGGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-740s21c1
Sequence:CCGGGCTCCAAAGAACTCGACTGTTCTCGAGAACAGTCGAGTTCTTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-1280s21c1
Sequence:CCGGGCCTTGGAGAATACAGAGATACTCGAGTATCTCTGTATTCTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005486.2-823s21c1
Sequence:CCGGGCGAGTGATGTCCGCCATATTCTCGAGAATATGGCGGACATCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028011
VALIDATED
TOM1L1 MISSION shRNA Bacterial Glycerol Stock
target of myb1 (chicken)-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-589s21c1
Sequence:CCGGCCTGCACTTTCTTCTATAATTCTCGAGAATTATAGAAGAAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1127s21c1
Sequence:CCGGTTCAGCCACAGAGGGATTTACCTCGAGGTAAATCCCTCTGTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1768s21c1
Sequence:CCGGGATCAATCATCCTACTATAAACTCGAGTTTATAGTAGGATGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-835s21c1
Sequence:CCGGGACGTGACTATGGAGCTAATTCTCGAGAATTAGCTCCATAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028011.2-885s21c1
Sequence:CCGGCCTTGGATATGAGAGGTTTACCTCGAGGTAAACCTCTCATATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028011
VALIDATED
TOM1L1 MISSION shRNA shRNA Plasmid DNA
target of myb1 (chicken)-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-589s21c1
Sequence:CCGGCCTGCACTTTCTTCTATAATTCTCGAGAATTATAGAAGAAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1127s21c1
Sequence:CCGGTTCAGCCACAGAGGGATTTACCTCGAGGTAAATCCCTCTGTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1768s21c1
Sequence:CCGGGATCAATCATCCTACTATAAACTCGAGTTTATAGTAGGATGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-835s21c1
Sequence:CCGGGACGTGACTATGGAGCTAATTCTCGAGAATTAGCTCCATAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028011.2-885s21c1
Sequence:CCGGCCTTGGATATGAGAGGTTTACCTCGAGGTAAACCTCTCATATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028011
VALIDATED
TOM1L1 MISSION shRNA Lentiviral Transduction Particles
target of myb1 (chicken)-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-589s21c1
Sequence:CCGGCCTGCACTTTCTTCTATAATTCTCGAGAATTATAGAAGAAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1127s21c1
Sequence:CCGGTTCAGCCACAGAGGGATTTACCTCGAGGTAAATCCCTCTGTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-1768s21c1
Sequence:CCGGGATCAATCATCCTACTATAAACTCGAGTTTATAGTAGGATGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028011.2-835s21c1
Sequence:CCGGGACGTGACTATGGAGCTAATTCTCGAGAATTAGCTCCATAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028011.2-885s21c1
Sequence:CCGGCCTTGGATATGAGAGGTTTACCTCGAGGTAAACCTCTCATATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks