EMAIL THIS PAGE TO A FRIEND

TOM1L2

target of myb1-like 2 (chicken)

UniProtKB ID: Q6ZVM7, B7Z7F4, Q86V61, Q8TDE7, Q96M88
Gene ID:
Mouse(216810) target of myb1-like 2 (chicken)
Rat(360537) target of myb1-like 2 (chicken)
Zebrafish(560327) target of myb1-like 2 (chicken)
dog(489540) target of myb1-like 2 (chicken)
chicken(416509) target of myb1-like 2
Horse(100052159) target of myb1-like 2 (chicken)
domestic cat(101101265) target of myb1-like 2 (chicken)
cow(616315) target of myb1-like 2 (chicken)
sheep(101112148) target of myb1-like 2 (chicken)
naked mole-rat(101701365) target of myb1-like 2 (chicken)
Domestic Rabbit(100348878) target of myb1-like 2 (chicken)
domestic guinea pig(100727480) target of myb1-like 2 (chicken)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033551 Rosetta Predictions human pricing
NM_001082968 Rosetta Predictions human pricing
NM_144678 Rosetta Predictions human pricing
NM_001108277 Rosetta Predictions rat pricing
NM_001039092 Rosetta Predictions mouse pricing
NM_001039093 Rosetta Predictions mouse pricing
NM_153080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308040 predicted 1147
2 SASI_Hs01_00084569 predicted 712
3 SASI_Hs01_00084570 predicted 1368
4 SASI_Hs02_00308041 predicted 952
5 SASI_Hs01_00084572 predicted 955
6 SASI_Hs01_00084573 predicted 1313
7 SASI_Hs01_00084575 predicted 1211
8 SASI_Hs02_00308042 predicted 674
9 SASI_Hs01_00084578 predicted 1118
10 SASI_Hs02_00308043 predicted 955
11 SASI_Hs01_00084571 predicted 891
12 SASI_Hs01_00084574 predicted 772
13 SASI_Hs01_00084576 predicted 1057
14 SASI_Hs01_00084577 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316782 predicted 1302
2 SASI_Hs02_00316783 predicted 862
3 SASI_Hs02_00316784 predicted 1518
4 SASI_Hs02_00316785 predicted 1100
5 SASI_Hs02_00316786 predicted 1099
6 SASI_Hs02_00316787 predicted 1458
7 SASI_Hs02_00316788 predicted 1357
8 SASI_Hs02_00316789 predicted 823
9 SASI_Hs02_00316790 predicted 1269
10 SASI_Hs02_00316791 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215567 predicted 666
2 SASI_Hs01_00215568 predicted 1327
3 SASI_Hs01_00215569 predicted 901
4 SASI_Hs01_00215570 predicted 905
5 SASI_Hs01_00215571 predicted 1260
6 SASI_Hs01_00215572 predicted 776
7 SASI_Hs01_00215573 predicted 1170
8 SASI_Hs01_00215574 predicted 1073
9 SASI_Hs01_00215575 predicted 1319
10 SASI_Hs01_00215576 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237074 predicted 550
2 SASI_Rn02_00237075 predicted 573
3 SASI_Rn02_00237076 predicted 959
4 SASI_Rn02_00237077 predicted 1283
5 SASI_Rn02_00237078 predicted 773
6 SASI_Rn02_00237079 predicted 981
7 SASI_Rn02_00237080 predicted 1202
8 SASI_Rn02_00237081 predicted 1176
9 SASI_Rn02_00237082 predicted 757
10 SASI_Rn02_00237083 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106348 predicted 801
2 SASI_Mm01_00106349 predicted 421
3 SASI_Mm01_00106351 predicted 499
4 SASI_Mm01_00106352 predicted 253
5 SASI_Mm01_00106353 predicted 1046
6 SASI_Mm01_00106354 predicted 474
7 SASI_Mm01_00106355 predicted 437
8 SASI_Mm01_00106356 predicted 848
9 SASI_Mm02_00289779 predicted 408
10 SASI_Mm01_00106357 predicted 266
11 SASI_Mm01_00106350 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134551 predicted 802
2 SASI_Mm01_00134552 predicted 421
3 SASI_Mm01_00134554 predicted 494
4 SASI_Mm01_00134555 predicted 248
5 SASI_Mm01_00134556 predicted 1050
6 SASI_Mm01_00134557 predicted 470
7 SASI_Mm01_00134558 predicted 436
8 SASI_Mm01_00134559 predicted 851
9 SASI_Mm02_00289780 predicted 403
10 SASI_Mm01_00134560 predicted 260
11 SASI_Mm01_00134553 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087782 predicted 803
2 SASI_Mm01_00087783 predicted 417
3 SASI_Mm01_00087785 predicted 499
4 SASI_Mm01_00087786 predicted 248
5 SASI_Mm01_00087787 predicted 1046
6 SASI_Mm01_00087788 predicted 475
7 SASI_Mm01_00087789 predicted 439
8 SASI_Mm01_00087790 predicted 848
9 SASI_Mm02_00342909 predicted 403
10 SASI_Mm01_00087791 predicted 261
11 SASI_Mm01_00087784 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144678
TOM1L2 MISSION shRNA Bacterial Glycerol Stock
target of myb1-like 2 (chicken)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-366s1c1
Sequence:CCGGCGAGATTTCATCGACAGTGTTCTCGAGAACACTGTCGATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1254s1c1
Sequence:CCGGCCATCTGTCATGGACGACATTCTCGAGAATGTCGTCCATGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-421s1c1
Sequence:CCGGCCCACCATTGTACAGGACAAACTCGAGTTTGTCCTGTACAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-831s1c1
Sequence:CCGGGTCAACGATGACCTCAACAATCTCGAGATTGTTGAGGTCATCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1101s1c1
Sequence:CCGGCGTGACGGCTTTGACATGTTTCTCGAGAAACATGTCAAAGCCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144678
TOM1L2 MISSION shRNA shRNA Plasmid DNA
target of myb1-like 2 (chicken)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-366s1c1
Sequence:CCGGCGAGATTTCATCGACAGTGTTCTCGAGAACACTGTCGATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1254s1c1
Sequence:CCGGCCATCTGTCATGGACGACATTCTCGAGAATGTCGTCCATGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-421s1c1
Sequence:CCGGCCCACCATTGTACAGGACAAACTCGAGTTTGTCCTGTACAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-831s1c1
Sequence:CCGGGTCAACGATGACCTCAACAATCTCGAGATTGTTGAGGTCATCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1101s1c1
Sequence:CCGGCGTGACGGCTTTGACATGTTTCTCGAGAAACATGTCAAAGCCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144678
TOM1L2 MISSION shRNA Lentiviral Transduction Particles
target of myb1-like 2 (chicken)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-366s1c1
Sequence:CCGGCGAGATTTCATCGACAGTGTTCTCGAGAACACTGTCGATGAAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1254s1c1
Sequence:CCGGCCATCTGTCATGGACGACATTCTCGAGAATGTCGTCCATGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-421s1c1
Sequence:CCGGCCCACCATTGTACAGGACAAACTCGAGTTTGTCCTGTACAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-831s1c1
Sequence:CCGGGTCAACGATGACCTCAACAATCTCGAGATTGTTGAGGTCATCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144678.2-1101s1c1
Sequence:CCGGCGTGACGGCTTTGACATGTTTCTCGAGAAACATGTCAAAGCCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153080
VALIDATED
TOM1L2 MISSION shRNA Bacterial Glycerol Stock
target of myb1-like 2 (chicken)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-296s1c1
Sequence:CCGGGCTGGAGACTTGTGTGAAGAACTCGAGTTCTTCACACAAGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-947s1c1
Sequence:CCGGCGTCAACGATGACCTCAACAACTCGAGTTGTTGAGGTCATCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-392s1c1
Sequence:CCGGCAAGAATAACCCTCCCACTATCTCGAGATAGTGGGAGGGTTATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-1441s1c1
Sequence:CCGGTCACAAGTGAAGAGTTCGATACTCGAGTATCGAACTCTTCACTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-391s1c1
Sequence:CCGGCCAAGAATAACCCTCCCACTACTCGAGTAGTGGGAGGGTTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153080
VALIDATED
TOM1L2 MISSION shRNA shRNA Plasmid DNA
target of myb1-like 2 (chicken)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-296s1c1
Sequence:CCGGGCTGGAGACTTGTGTGAAGAACTCGAGTTCTTCACACAAGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-947s1c1
Sequence:CCGGCGTCAACGATGACCTCAACAACTCGAGTTGTTGAGGTCATCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-392s1c1
Sequence:CCGGCAAGAATAACCCTCCCACTATCTCGAGATAGTGGGAGGGTTATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-1441s1c1
Sequence:CCGGTCACAAGTGAAGAGTTCGATACTCGAGTATCGAACTCTTCACTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-391s1c1
Sequence:CCGGCCAAGAATAACCCTCCCACTACTCGAGTAGTGGGAGGGTTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153080
VALIDATED
TOM1L2 MISSION shRNA Lentiviral Transduction Particles
target of myb1-like 2 (chicken)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-296s1c1
Sequence:CCGGGCTGGAGACTTGTGTGAAGAACTCGAGTTCTTCACACAAGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-947s1c1
Sequence:CCGGCGTCAACGATGACCTCAACAACTCGAGTTGTTGAGGTCATCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-392s1c1
Sequence:CCGGCAAGAATAACCCTCCCACTATCTCGAGATAGTGGGAGGGTTATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153080.1-1441s1c1
Sequence:CCGGTCACAAGTGAAGAGTTCGATACTCGAGTATCGAACTCTTCACTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153080.1-391s1c1
Sequence:CCGGCCAAGAATAACCCTCCCACTACTCGAGTAGTGGGAGGGTTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks