EMAIL THIS PAGE TO A FRIEND

TOMM20

translocase of outer mitochondrial membrane 20 homolog (yeast)

Synonyms: MAS20 MOM19 TOM20
UniProtKB ID: Q15388, A8K195, Q498B3, Q6IBT4
Gene ID:
Mouse(67952) translocase of outer mitochondrial membrane 20 homolog (yeast)
Rat(266601) translocase of outer mitochondrial membrane 20 homolog (yeast)
chicken(426309) translocase of outer mitochondrial membrane 20 homolog (yeast)
dog(100682999) translocase of outer mitochondrial membrane 20 homolog (yeast)
cow(781575) translocase of outer mitochondrial membrane 20 homolog (yeast)
Goat(100861088) translocase of outer mitochondrial membrane 20 homolog (yeast)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011562 Anti-TOMM20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0009804M1 Monoclonal Anti-TOMM20 antibody produced in mouse clone 4F3, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014765 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014765 Rosetta Predictions human pricing
NM_152935 Rosetta Predictions rat pricing
NM_024214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189669 predicted 268
2 SASI_Hs01_00189673 predicted 482
3 SASI_Hs01_00189674 predicted 467
4 SASI_Hs01_00189675 predicted 347
5 SASI_Hs01_00189677 predicted 327
6 SASI_Hs02_00346251 predicted 447
7 SASI_Hs02_00346252 predicted 469
8 SASI_Hs02_00346253 predicted 280
9 SASI_Hs01_00189668 predicted 370
10 SASI_Hs01_00189670 predicted 470
11 SASI_Hs01_00189671 predicted 364
12 SASI_Hs01_00189672 predicted 370
13 SASI_Hs01_00189676 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076914 predicted 371
2 SASI_Rn01_00076915 predicted 350
3 SASI_Rn02_00268920 predicted 677
4 SASI_Rn01_00076916 predicted 548
5 SASI_Rn01_00076917 predicted 556
6 SASI_Rn01_00076918 predicted 469
7 SASI_Rn01_00076919 predicted 485
8 SASI_Rn01_00076921 predicted 671
9 SASI_Rn02_00268921 predicted 329
10 SASI_Rn02_00268922 predicted 625
11 SASI_Rn01_00076913 predicted 336
12 SASI_Rn01_00076920 predicted 650
13 SASI_Rn01_00076922 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327578 predicted 286
2 SASI_Mm02_00327579 predicted 370
3 SASI_Mm02_00327580 predicted 352
4 SASI_Mm02_00327581 predicted 480
5 SASI_Mm01_00170965 predicted 616
6 SASI_Mm02_00327582 predicted 469
7 SASI_Mm02_00327583 predicted 387
8 SASI_Mm01_00170967 predicted 466
9 SASI_Mm02_00327584 predicted 328
10 SASI_Mm02_00327585 predicted 321
11 SASI_Mm01_00170964 predicted 427
12 SASI_Mm01_00170966 predicted 454
13 SASI_Mm01_00170968 predicted 782
14 SASI_Mm01_00170969 predicted 666
15 SASI_Mm01_00170970 predicted 694
16 SASI_Mm01_00170971 predicted 660
17 SASI_Mm01_00170972 predicted 546
18 SASI_Mm01_00170973 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024214
VALIDATED
TOMM20 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 20 homolog (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-545s1c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024214.1-299s1c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-265s1c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-485s1c1
Sequence:CCGGCCGACCATTAGTCAGAGAATTCTCGAGAATTCTCTGACTAATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-200s1c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-265s21c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-200s21c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-545s21c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-371s21c1
Sequence:CCGGGGTGTGGACCACCTGACAAATCTCGAGATTTGTCAGGTGGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-299s21c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024214
VALIDATED
TOMM20 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 20 homolog (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-545s1c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024214.1-299s1c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-265s1c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-485s1c1
Sequence:CCGGCCGACCATTAGTCAGAGAATTCTCGAGAATTCTCTGACTAATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-200s1c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-265s21c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-200s21c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-545s21c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-371s21c1
Sequence:CCGGGGTGTGGACCACCTGACAAATCTCGAGATTTGTCAGGTGGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-299s21c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024214
VALIDATED
TOMM20 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 20 homolog (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-545s1c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024214.1-299s1c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-265s1c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-485s1c1
Sequence:CCGGCCGACCATTAGTCAGAGAATTCTCGAGAATTCTCTGACTAATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024214.1-200s1c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-265s21c1
Sequence:CCGGGCTTTCCAAGTTACCTGATTTCTCGAGAAATCAGGTAACTTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-200s21c1
Sequence:CCGGCCCAACTTCAAGAACAGGCTTCTCGAGAAGCCTGTTCTTGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-545s21c1
Sequence:CCGGGCCAGATACCAACAAGATAAACTCGAGTTTATCTTGTTGGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-371s21c1
Sequence:CCGGGGTGTGGACCACCTGACAAATCTCGAGATTTGTCAGGTGGTCCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024214.1-299s21c1
Sequence:CCGGGCAGTTCAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014765
VALIDATED
TOMM20 MISSION shRNA Bacterial Glycerol Stock
translocase of outer mitochondrial membrane 20 homolog (yeast)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-294s1c1
Sequence:CCGGGCTGTTCAGAAGTTCTTCCTTCTCGAGAAGGAAGAACTTCTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-315s1c1
Sequence:CCGGGAAGAAATACAGCTTGGTGAACTCGAGTTCACCAAGCTGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014765.1-2615s1c1
Sequence:CCGGCCCAGAAATGTAATTGCCAAACTCGAGTTTGGCAATTACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-222s1c1
Sequence:CCGGCGAAGAAAGAAACAGAAGCTTCTCGAGAAGCTTCTGTTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-2030s1c1
Sequence:CCGGCGACTCACATTTGAGGACTTTCTCGAGAAAGTCCTCAAATGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-537s21c1
Sequence:CCGGAGCAGTTACTGCAGGTCTTACCTCGAGGTAAGACCTGCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-951s21c1
Sequence:CCGGATATGACATGGCTTATGTTAACTCGAGTTAACATAAGCCATGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1129s21c1
Sequence:CCGGTGATCCTTTCTTTCCATTTAACTCGAGTTAAATGGAAAGAAAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-491s21c1
Sequence:CCGGGGCGTAGACCATCTGACAAATCTCGAGATTTGTCAGATGGTCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1146s21c1
Sequence:CCGGTTAATCTCTGAGACGTAAATACTCGAGTATTTACGTCTCAGAGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-463s21c1
Sequence:CCGGGTTACTAGCTCAAGGTGAATACTCGAGTATTCACCTTGAGCTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014765
VALIDATED
TOMM20 MISSION shRNA shRNA Plasmid DNA
translocase of outer mitochondrial membrane 20 homolog (yeast)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-294s1c1
Sequence:CCGGGCTGTTCAGAAGTTCTTCCTTCTCGAGAAGGAAGAACTTCTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-315s1c1
Sequence:CCGGGAAGAAATACAGCTTGGTGAACTCGAGTTCACCAAGCTGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014765.1-2615s1c1
Sequence:CCGGCCCAGAAATGTAATTGCCAAACTCGAGTTTGGCAATTACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-222s1c1
Sequence:CCGGCGAAGAAAGAAACAGAAGCTTCTCGAGAAGCTTCTGTTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-2030s1c1
Sequence:CCGGCGACTCACATTTGAGGACTTTCTCGAGAAAGTCCTCAAATGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-537s21c1
Sequence:CCGGAGCAGTTACTGCAGGTCTTACCTCGAGGTAAGACCTGCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-951s21c1
Sequence:CCGGATATGACATGGCTTATGTTAACTCGAGTTAACATAAGCCATGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1129s21c1
Sequence:CCGGTGATCCTTTCTTTCCATTTAACTCGAGTTAAATGGAAAGAAAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-491s21c1
Sequence:CCGGGGCGTAGACCATCTGACAAATCTCGAGATTTGTCAGATGGTCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1146s21c1
Sequence:CCGGTTAATCTCTGAGACGTAAATACTCGAGTATTTACGTCTCAGAGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-463s21c1
Sequence:CCGGGTTACTAGCTCAAGGTGAATACTCGAGTATTCACCTTGAGCTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014765
VALIDATED
TOMM20 MISSION shRNA Lentiviral Transduction Particles
translocase of outer mitochondrial membrane 20 homolog (yeast)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-294s1c1
Sequence:CCGGGCTGTTCAGAAGTTCTTCCTTCTCGAGAAGGAAGAACTTCTGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-315s1c1
Sequence:CCGGGAAGAAATACAGCTTGGTGAACTCGAGTTCACCAAGCTGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014765.1-2615s1c1
Sequence:CCGGCCCAGAAATGTAATTGCCAAACTCGAGTTTGGCAATTACATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014765.1-222s1c1
Sequence:CCGGCGAAGAAAGAAACAGAAGCTTCTCGAGAAGCTTCTGTTTCTTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014765.1-2030s1c1
Sequence:CCGGCGACTCACATTTGAGGACTTTCTCGAGAAAGTCCTCAAATGTGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-537s21c1
Sequence:CCGGAGCAGTTACTGCAGGTCTTACCTCGAGGTAAGACCTGCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-951s21c1
Sequence:CCGGATATGACATGGCTTATGTTAACTCGAGTTAACATAAGCCATGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1129s21c1
Sequence:CCGGTGATCCTTTCTTTCCATTTAACTCGAGTTAAATGGAAAGAAAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-491s21c1
Sequence:CCGGGGCGTAGACCATCTGACAAATCTCGAGATTTGTCAGATGGTCTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014765.2-1146s21c1
Sequence:CCGGTTAATCTCTGAGACGTAAATACTCGAGTATTTACGTCTCAGAGATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014765.2-463s21c1
Sequence:CCGGGTTACTAGCTCAAGGTGAATACTCGAGTATTCACCTTGAGCTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks